LG F1024ND
|
|
Bookmark LG F1024ND |
About LG F1024NDHere you can find all about LG F1024ND like manual and other informations. For example: review.
LG F1024ND manual (user guide) is ready to download for free.
On the bottom of page users can write a review. If you own a LG F1024ND please write about it to help other people. [ Report abuse or wrong photo | Share your LG F1024ND photo ]
Manual
Preview of first few manual pages (at low quality). Check before download. Click to enlarge.
Download
(Czech)LG F1024ND Washing Machine, size: 2.5 MB |
Download
(English)Check if your language version is avaliable. Most of manuals are avaliable in many languages. |
LG F1024ND
Video review
Pra ka LG F1024ND
User reviews and opinions
No opinions have been provided. Be the first and add a new opinion/review.
Documents

AT1 receptor-activated signaling mediates angiotensin IV-induced renal cortical vasoconstriction in rats
Xiao C. Li, Duncan J. Campbell, Mitsuru Ohishi, Shao Yuan and Jia L. Zhuo
Am J Physiol Renal Physiol 290:F1024-F1033, 2006. First published 27 December 2005; doi:10.1152/ajprenal.00221.2005 You might find this additional info useful. This article cites 43 articles, 25 of which can be accessed free at: http://ajprenal.physiology.org/content/290/5/F1024.full.html#ref-list-1 This article has been cited by 4 other HighWire hosted articles Intracellular ANG II directly induces in vitro transcription of TGF-1, MCP-1, and NHE-3 mRNAs in isolated rat renal cortical nuclei via activation of nuclear AT1a receptors Xiao C. Li and Jia L. Zhuo Am J Physiol Cell Physiol, April 1, 2008; 294 (4): C1034-C1045. [Abstract] [Full Text] [PDF] In vivo regulation of AT1a receptor-mediated intracellular uptake of [125I]Val5-ANG II in the kidneys and adrenals of AT 1a receptor-deficient mice Xiao C. Li and Jia L. Zhuo Am J Physiol Renal Physiol, February 1, 2008; 294 (2): F293-F302. [Abstract] [Full Text] [PDF] Selective knockdown of AT1 receptors by RNA interference inhibits Val5-ANG II endocytosis and NHE-3 expression in immortalized rabbit proximal tubule cells Xiao C. Li and Jia L. Zhuo Am J Physiol Cell Physiol, July 1, 2007; 293 (1): C367-C378. [Abstract] [Full Text] [PDF] Characterization and localization of Ac-SDKP receptor binding sites using 125I-labeled Hpp-Aca-SDKP in rat cardiac fibroblasts Jia L. Zhuo, Oscar A. Carretero, Hongmei Peng, Xiao C. Li, Domenico Regoli, Witold Neugebauer and Nour-Eddine Rhaleb Am J Physiol Heart Circ Physiol, February 1, 2007; 292 (2): H984-H993. [Abstract] [Full Text] [PDF] Updated information and services including high resolution figures, can be found at: http://ajprenal.physiology.org/content/290/5/F1024.full.html Additional material and information about AJP - Renal Physiology can be found at: http://www.the-aps.org/publications/ajprenal
Downloaded from ajprenal.physiology.org on June 8, 2011
This infomation is current as of June 8, 2011.
AJP - Renal Physiology publishes original manuscripts on a broad range of subjects relating to the kidney, urinary tract, and their respective cells and vasculature, as well as to the control of body fluid volume and composition. It is published 12 times a year (monthly) by the American Physiological Society, 9650 Rockville Pike, Bethesda MD 20814-3991. Copyright 2006 by the American Physiological Society. ISSN: 0363-6127, ESSN: 1522-1466. Visit our website at http://www.the-aps.org/.
Am J Physiol Renal Physiol 290: F1024 F1033, 2006. First published December 27, 2005; doi:10.1152/ajprenal.00221.2005.
Xiao C. Li,1 Duncan J. Campbell,2 Mitsuru Ohishi,3 Shao Yuan,1 and Jia L. Zhuo1
Division of Hypertension and Vascular Research, Henry Ford Hospital, Detroit, Michigan; 2St. Vincents Institute of Medical Research and Department of Medicine, University of Melbourne, Fitzroy, Victoria; and 3Department of Geriatric Medicine, Graduate School of Medicine, Osaka University, Osaka, Japan
Submitted 25 May 2005; accepted in nal form 14 December 2005
Li, Xiao C., Duncan J. Campbell, Mitsuru Ohishi, Shao Yuan, and Jia L. Zhuo. AT1 receptor-activated signaling mediates angiotensin IV-induced renal cortical vasoconstriction in rats. Am J Physiol Renal Physiol 290: F1024 F1033, 2006. First published December 27, 2005; doi:10.1152/ajprenal.00221.2005.Angiotensin IV (ANG IV), an active ANG II fragment, has been shown to induce systemic and renal cortical effects by binding to ANG IV (AT4) receptors and activating unique signaling transductions unrelated to classical type 1 (AT1) or type 2 (AT2) receptors. We tested whether ANG IV exerts systemic and renal cortical effects on blood pressure, renal microvascular smooth muscle cells (VSMCs), and glomerular mesangial cells (MC) and, if so, whether AT1 receptor-activated signaling is involved. In anesthetized rats, systemic infusion of ANG II, ANG III, or ANG IV (0.01, 0.1, and 1.0 nmol kg1 min1 iv) caused dose-dependent increases in mean arterial pressure (MAP) and decreases in renal cortical blood ow (CBF; P 0.01). ANG II also induced dosedependent reductions in renal medullary blood ow (P 0.01), whereas ANG IV did not. ANG IV-induced pressor and renal cortical vasoconstriction were completely abolished by AT1 receptor blockade with losartan (5 mg/kg iv; P 0.05). When ANG IV (1 nmol kg1 min1) was infused directly in the renal artery, CBF was reduced by 30%, and the response was also blocked by losartan (P 0.01). In the renal cortex, unlabeled ANG IV displaced 125Ilabeled [Sar1,Ile8]ANG II binding, whereas unlabeled ANG II (10 M) inhibited 125I-labeled Nle1-ANG IV (AT4) binding in a concentration-dependent manner (P 0.01). In freshly isolated renal VSMCs, ANG IV (100 nM) increased intracellular Ca2 concentration, and the effect was blocked by losartan and U-73122, a selective inhibitor of phospholipase C/inositol trisphosphate/Ca2 signaling (1 M). In cultured rat MCs, ANG IV (10 nM) induced mitogenactivated protein kinase extracellular/signal-regulated kinase 1/2 phosphorylation via AT1 receptor- and phospholipase C-activated signaling. These results suggest that, at nanomolar concentrations, ANG IV can increase MAP and induce renal cortical effects by interacting with AT1 receptor-activated signaling. angiotensin II; angiotensin IV; angiotensin type 1 receptor; angiotensin type 4 receptor; renal cortical blood ow; mitogen-activated protein kinases
HIGH-AFFINITY RECEPTOR BINDING sites and the physiological role of bioactive angiotensin fragments are gaining increasing attention after molecular cloning of type 1 (AT1) and type 2 (AT2) receptors for the octapeptide ANG II. It is now established that AT1 receptors mediate most (if not all) classic effects of ANG II, including potent vasoconstriction, aldosterone synthesis, cell growth, and body uid and electrolyte
homeostasis, whereas AT2 receptors oppose most (if not all) AT1 receptor-mediated effects in cardiovascular and renal cells (4, 10, 16, 39, 40). By contrast, neither receptor pharmacology nor the physiological or pathological role of other ANG II fragments is fully understood, with the possible exception of ANG III (des-Asp1-ANG II), which also activates AT1 receptors in most tissues or cells (3, 5, 12, 13, 16). ANG IV, which is formed by removing the rst NH2-terminal amino acid (Arg2) from ANG III with aminopeptidase N and/or aminopeptidase B (3, 1214, 16), was initially thought to be biologically inert but has recently been shown to have various effects in different tissues or cells by binding to high-afnity angiotensin type 4 receptors (AT4) or insulin-regulated aminopeptidase (IRAP; see Refs. 2, 13, 17, 23, 35, 37). It is unclear whether ANG IV acts as an exclusive agonist for the putative AT4 receptor alone or as a partial but active agonist for the AT1 receptor, mediating its widely reported cardiovascular and renal effects (1, 17, 28 32, 34). ANG IV has been reported to cause both vasodilatation and vasoconstriction (1, 15, 18, 19, 35). For example, infusion of ANG IV directly in cerebral or renal arteries increases cerebral blood ow and renal cortical blood ow (CBF) via a mechanism that appears to be mediated by the AT4 receptor and nitric oxide (NO; see Refs. 15, 22, 37). In contrast, systemic or intrarenal arterial administration of ANG IV reportedly caused systemic and renal vasoconstriction that was completely prevented by pretreatment with losartan, suggesting an AT1 receptor-mediated response (11, 18, 19). However, it is not clear whether the reported different responses to ANG IV are only secondary to a systemic effect or the result of a direct intrarenal action, because previous studies dealt primarily with larger regional arterial or whole kidney blood ow responses to ANG IV and none of them has directly compared systemic and intrarenal effects of ANG IV. To resolve the differences between renal cortical vasoconstrictor and vasodilator effects of ANG IV, it is important to study whether classical AT1 receptor-activated signaling pathways are involved at the cellular levels. The present study was therefore performed to determine 1) concentration-dependent systemic arterial pressure and renal CBF responses to systemic infusion of ANG IV, ANG III, and ANG II; 2) whether AT1 receptors are involved in systemic ANG IV-induced responses; 3) whether direct intrarenal arterial infusion of ANG IV induces renal cortical vasoconstriction by activating AT1 receptors; 4) whether ANG IV competes for AT1 receptor binding in
www.ajprenal.org
290 MAY 2006
AT1 RECEPTOR SIGNALING AND ANG IV RESULTS
42, 43). Binding competition data were analyzed using GraphPad Prism 4.0 (GraphPad Software). Effects of ANG IV on Intracellular Ca Renal VSMCs
Concentration Levels in
Concentration-Dependent Responses of MAP, Renal CBF, and MBF to Systemic Administration of ANG IV, ANG III, or ANG II At the lowest dose (0.01 nmolkg1 min1 iv), ANG IV did not alter MAP, whereas ANG II increased it by mmHg (Fig. 1A). However, ANG IV increased MAP signicantly at
Increased intracellular Ca2 concentration ([Ca2]i) is the foremost classical signaling for AT1 receptor-mediated vasoconstriction by ANG II (4, 12, 16, 25, 33). To determine whether ANG IV induces renal cortical vasoconstriction by increasing [Ca2]i in renal VSMCs, SD rats were anesthetized, and renal VSMCs were isolated as described previously for Ca2 imaging experiments (25, 33). Freshly isolated renal VSMCs were plated on cover slips and loaded with the Ca2-sensitive uorescent dye fura 2 (Molecular Probes) at 2 M for 30 min at 37C. After washes, cover slips were mounted on a perfusion chamber maintained at 37C, which in turn was mounted on a Nikon Eclipse TE2000-U inverted uorescence microscope coupled with a Lambda DG4 illumination system (Sutter Instruments). Ratiometric Ca2 measurements (340/380 ratio) in response to ANG IV were made continuously at 3-s intervals for up to 10 min using a MetaFluor Fluorescence Imaging System (Universal Imaging). To enable calculation of the average magnitude of peak [Ca2]i responses to ANG IV, the imaging system was rst calibrated using a fura 2 Calcium Imaging Calibration Kit with Ca2 concentrations ranging from 0 to 10 mM (Molecular Probes). Ca2 responses to ANG IV were examined further in cells pretreated with losartan (10 M) or U-73122 (1 M) for 30 min, a selective inhibitor for phospholipase C (PLC)-activated Ca2 signaling. Effects of ANG IV on Mitogen-activated Protein Kinase Extracellular/Signal-Regulated Kinase 1/2 Phosphorylation in Rat Glomerular MCs Activation of mitogen-activated protein kinase extracellular/signalregulated kinase (ERK) 1/2 phosphorylation is another classical signaling pathway for AT1 receptor-mediated effects of ANG II (4, 16, 20, 21). If ANG IV interacts with AT1 receptor-activated signaling, we expect that ANG IV would also induce ERK1/2 phosphorylation in a manner similar to ANG II. Cultured rat MCs, a well-described target for AT1 receptor-mediated effects of ANG II, were obtained from ATCC and subcultured to 80% conuence in six-well plates containing RPMI-1640 medium supplemented with 12% FBS. MCs were rst starved for 24 h in serum-free medium before stimulation by ANG IV (10 nM) for 5 min. The effects of ANG IV on ERK1/2 phosphorylation were examined further in the presence of losartan (10 M) or U-73122 (1 M) to determine the role of AT1 receptoractivated PLC/inositol trisphosphate (IP3)/[Ca2]i signaling. After stimulation, MCs were washed with ice-cold PBS and lysed with a modied RIPA buffer, and protein samples were extracted. Protein concentrations were determined using a BCA protein assay kit (Pierce), and total and phosphorylated ERK1/2 were measured by Western blot using selective antibodies targeted to total (SC-93; 1:5,000) or phosphorylated ERK1/2 (SC-7383; 1:200; Santa Cruz). Data Analysis and Statistics Data are presented as means SE. Differences between experimental periods within each group were compared using one-way ANOVA with repeated comparisons (Tukeys test). Differences between ANG IV and ANG II at the same concentration(s) were analyzed by unpaired t-test. The competing effects of unlabeled ANG IV for AT1 receptor binding or unlabeled ANG II and losartan for AT4 receptor binding were analyzed using an unpaired Students t-test. P 0.05 was considered signicant.
Fig. 1. Dose-dependent pressor and renal vasoconstrictor effects of iv infusion of increasing concentrations of ANG II, ANG III, and ANG IV. All three ANG peptides increased mean arterial pressure (MAP) and decreased renal cortical blood ow (CBF) in a dose-dependent fashion, exhibiting potency in the order: ANG II ANG III ANG IV. ANG II and ANG III also decreased renal medullary blood ow (MBF) at higher doses, whereas ANG IV had no effect. P 0.05 vs. baseline ANG IV response (*), vs. baseline ANG III response (), and vs. baseline ANG II response (#). www.ajprenal.org
0.1 (20%, P 0.05) and 1 (33%, P 0.05) nmolkg1 min1 in a dose-dependent manner. By contrast, ANG II induced dose-dependent pressor effects at all concentrations examined (P 0.05, Fig. 1A). ANG IV at the lowest dose had no effect on renal CBF; however, at higher concentrations it decreased CBF in a dose-dependent manner (Fig. 1B, P 0.05). Again, ANG II induced more potent renal cortical vasoconstriction in a concentration-dependent fashion (Fig. 1B, P 0.05). ANG IV had no effect on MBF at all concentrations examined [Fig. 1C, not signicant (NS)]. By contrast, ANG II was potent at the two higher doses (Fig. 1C, P 0.05). The effects of ANG III on MAP, renal CBF, and MBF were between those of ANG IV and ANG II. Effects of AT1 and AT2 Receptor Blockade on Systemic ANG IV-Induced Pressor and Renal CBF Responses Because ANG IV produced pressor and renal vasoconstrictor effects at 0.1 and 1 nmolkg1 min1, we next tested whether these effects were mediated by interaction with AT1 or AT2 receptors. As shown in Fig. 2, AT2 receptor blockade with PD-123319 had no effect on ANG IV-induced MAP (top) and renal CBF responses (middle), suggesting that the AT2 receptor is not involved. By contrast, blockage of the AT1 receptor with losartan abolished the pressor effect of ANG IV (Fig. 2, top, P 0.05). Losartan also reversed the ANG IV-induced decrease in CBF to a level signicantly above control (Fig. 2, middle) and increased MBF (Fig. 2, bottom), indicating a tonic inuence of endogenous ANG II via AT1 receptors on the renal cortical and medullary microcirculation (P 0.05). In a reverse protocol designed to clarify whether ANG IV can induce systemic or renal vasodilatation after AT1 receptor blockade, pretreatment with losartan alone before ANG IV infusion did not decrease MAP signicantly but did prevent ANG IV-induced increases in MAP (data not shown). Effects of Direct Intrarenal Arterial Infusion of ANG IV on MAP and Renal CBF Figure 3 shows that intrarenal arterial infusion of ANG IV had no effect on MAP (top) but signicantly decreased renal CBF by 30% (70.4 3.2% of control, P 0.01; Fig. 3, bottom), suggesting that ANG IV directly induced renal cortical vasoconstriction. Coadministration of ANG IV with losartan restored renal CBF to a level not signicantly different from control (96 5.3% of control, NS). Effects of ANG IV on Renal Cortical AT1 Receptor Binding as Visualized by Quantitative In Vitro Autoradiography Quantitative in vitro autoradiography was performed to examine whether ANG IV competes for AT1 receptor binding in the renal cortex. As expected, ANG II receptors in the renal cortex were predominantly the AT1 subtype (Fig. 4). AT1 receptors are located primarily in the cortex and the inner stripe of the outer medulla (39, 41 43). Renal AT1 receptor binding was completely inhibited by 10 M unlabeled ANG II (Fig. 4B) and losartan (Fig. 4D) and also partially displaced by unlabeled ANG IV (10 M; Fig. 4C). As shown in Fig. 4D, unlabeled ANG II, ANG IV, and losartan competed for specic AT1 receptor binding in a concentration-dependent manner. The inhibitory potency (IC50) on AT1 receptor binding for
Fig. 2. Effects of angiotensin type 2 (AT2) and/or type 1 (AT1) receptor blockade on MAP and CBF and MBF responses to iv infusion of ANG IV (1 nmol kg1 min1). ANG IV increased MAP and decreased CBF. These responses were not altered by the AT2 receptor antagonist PD-123319 (PD) but were reversed by the AT1 receptor antagonist losartan (Los). P 0.05 vs. control (*) and vs. ANG IV response (#).
ANG II, ANG IV, and losartan was 3.8 0.3, 300 15, and 10.2 0.5 nM, respectively (Fig. 4D). Effects of ANG II or Losartan on Renal Cortical AT4 Receptor Binding as Visualized by Quantitative In Vitro Autoradiography Figure 5 shows renal cortical AT4 receptor binding using a radiolabeled, specic ANG IV agonist (125I-Nle1-ANG IV) and the effects of unlabeled ANG IV, divalinal ANG IV (an ANG IV receptor-selective antagonist), ANG II, losartan (AT1 receptor-selective antagonist), and PD-123319 (AT2 receptorwww.ajprenal.org
Effects of ANG IV on Mitogen-Activated Protein Kinase ERK1/2 Phosphorylation in Rat Glomerular MCs Glomerular MCs are another well-described target for ANG II, acting via AT1 receptors in the renal cortex. ANG II has been shown to activate ERK1/2 phosphorylation via AT1 receptors in MCs (20, 21). As an active agonist of ANG II, ANG IV would be expected to activate AT1 receptor-mediated phosphorylation of mitogen-activated protein kinase ERK1/2, inducing a downstream AT1 receptor signaling in MCs (4, 16, 20, 21). As expected, ANG II (1 nM) induced a twofold increase in ERK1/2 phosphorylation via activation of AT1 receptors (data not shown). ANG IV (10 nM) also more than doubled ERK1/2 phosphorylation in MCs (Fig. 7). Pretreatment with losartan (10 M) for 30 min signicantly inhibited ANG IV-induced ERK1/2 phosphorylation, whereas losartan alone had no effect (Fig. 7). U-73122, a selective inhibitor of PLC/IP3/[Ca2]i signaling, also signicantly attenuated ANG IV-induced ERK1/2 signaling (Fig. 8).
DISCUSSION
Fig. 3. Effects of intrarenal arterial infusion of ANG IV (1 nmol kg1 min1) on MAP and renal CBF in anesthetized rats. Intrarenal infusion of ANG IV did not affect MAP but reduced renal CBF. Coadministration of ANG IV with losartan blocked intrarenal ANG IV-induced renal cortical vasoconstriction. P 0.01 vs. control (**) and vs. ANG IV ().
selective antagonist) on 125I-Nle1-ANG IV receptor binding. Specic AT4 receptor binding predominated in the inner cortex with a moderate level in the supercial cortex (Fig. 5A). Both unlabeled ANG IV (Fig. 5B) and divalinal ANG IV (Fig. 5C) displaced 80 90% of ANG IV receptor binding, whereas unlabeled ANG II (Fig. 5D) and losartan (Fig. 5E) inhibited ANG IV receptor binding by between 30 and 50%. However, PD-123319 had no effect on ANG IV receptor binding (Fig. 5F). Effects of ANG IV on [Ca2]i Levels in Renal VSMCs Whether ANG IV can increase [Ca2]i in renal VSMCs has not been studied to our knowledge; however, Chansel et al. (12) showed that at 100 nM to 1 M, ANG IV induced [Ca2]i responses in rat glomerular MCs via activation of AT1 receptors. Figure 6 shows that ANG IV (100 nM) induced a sustained increase in [Ca2]i in two representative renal VSMCs (top). Basal [Ca2]i in renal VSMCs averaged nM, which was increased to nM during ANG IV stimulation (Fig. 6, bottom). ANG IV-induced increases in [Ca2]i levels were prevented by pretreating the cells with losartan (10 M, P 0.01).
The present study demonstrates the following ve key ndings: 1) in anesthetized rats, systemic infusion of ANG IV increased MAP and decreased renal CBF in a dose-dependent manner without affecting MBF in the inner stripe of the outer medulla; 2) ANG IV-induced systemic and renal cortical vasoconstriction was abolished by the AT1 receptor antagonist losartan but not by the AT2 receptor antagonist PD-123319; 3) direct intrarenal infusion of ANG IV also induced renal cortical vasoconstriction, and the response was blocked by losartan; 4) unlabeled ANG IV inhibited AT1 receptor binding, and conversely unlabeled ANG II, and losartan inhibited AT4 receptor binding to some extent in the rat kidney; and 5) ANG IV activated AT1 receptors to increase [Ca2]i in rat renal VSMCs and induced mitogen-activated protein kinase ERK1/2 phosphorylation in MCs. Our results are consistent with the concept that, at subnanomolar to nanomolar concentrations, ANG IV behaves as an active agonist for the AT1 receptor (5, 11, 12, 18, 19, 28) and may play a physiological role in the regulation of blood pressure and intrarenal microcirculation. Currently, there are conicting reports on the systemic and renal hemodynamic effects of ANG IV. Both systemic and/or renal vasoconstrictor (11, 18, 19, 30, 36) or vasodilator responses to ANG IV (15, 22, 35, 37) have been observed. Coleman et al. (15) were the rst to describe the renal vasodilator response to intrarenally administered ANG IV using laser-Doppler owmetry in the rat supercial renal cortex. Because the renal vasodilator effects of ANG IV were not affected by an AT1 (losartan) or AT2 receptor blocker (PD123319), but were abolished by divalinal-ANG IV, an ANG IV receptor antagonist, or by blocking NO release with NG-nitroL-arginine methyl ester, they suggested that activation of intrarenal AT4 receptors mediates intrarenal vasodilatation via an NO-dependent mechanism (15). However, divalinal-ANG IV and ANG IV have been shown to substantially increase [Ca2]i levels in human proximal tubule cells, a characteristic signal for AT1 receptor activation (24). Subsequent in vivo and in vitro studies using other approaches in various vascular beds failed to uncover a vasodilator effect for the hexapeptide (11, 18, 19, 36). Using chronically implanted pulsed Doppler ow probes in conscious rats, Gardiner et al. found that, at doses up
Fig. 4. Autoradiographs showing the effects of unlabeled ANG II or IV on specic AT1 receptor binding in the rat kidney. A: AT1 receptor binding. B: AT1 receptor binding was completely displaced by unlabeled ANG II (10 M). C: AT1 receptor binding was partially inhibited by unlabeled ANG IV (10 M). D: concentration-dependent inhibition of AT1 receptor binding by increasing concentrations of unlabeled ANG II, ANG IV, and losartan (1010 to 104 M). E: quantitative levels of AT1 receptor (R) binding in the absence and presence of unlabeled ANG II or ANG IV. Color bars: red represents the highest level of binding, whereas blue shows the background level. **P 0.01 vs. total AT1 receptor binding in the absence of unlabeled ANG II or ANG IV (10 M). C, cortex; IS, inner stripe of the outer medulla; IM, inner medulla.
to 125 pmol/kg, ANG IV did not alter blood pressure, renal and mesenteric blood ow, or vascular conductance; however, at higher doses it increased blood pressure and signicantly reduced renal and mesenteric blood ow in a dose-dependent manner. Pressor and renal vasoconstrictor responses to ANG IV were abolished by pretreatment with losartan but were not altered by L-arginine, suggesting an AT1 receptor-mediated event independent of NO (19). Furthermore, Fitzgerald et al. (18) monitored the whole kidney blood ow response to increasing doses of ANG IV (10 1,000 pmol/min) infused directly in the renal artery of anesthetized rats and observed dose-related reductions in total renal blood ow using transittime ow probes. As before, pretreatment with losartan abolished the vasoconstrictor response to ANG IV (18). Finally, van Rodijnen et al. (36) recently described the AT1 receptormediated vasoconstrictor effects of the ANG II fragments ANG IV and ANG (I-VII) in rat renal interlobular arteries and in afferent and efferent arterioles using the isolated perfused hydronephrotic kidney. Thus most (if not all) studies suggest
that ANG IV exerts an AT1 receptor-mediated vasoconstrictor effect on systemic blood pressure and large renal blood vessels. However, it can be argued that renal vasoconstrictor effects of ANG IV may be secondary to a systemic pressor response because none of these studies have directly compared the renal cortical hemodynamic responses to intrarenal vs. systemic ANG IV administration, or may only apply to large renal arteries or total renal blood ow (18, 19, 36) because those approaches may not uncover intrarenal microvascular vasodilatation induced by ANG IV (15, 22). Based on our ndings, we believe this is unlikely. Like Coleman et al. (15), we also used laser-Doppler owmetry to monitor renal CBF responses to ANG IV and ANG II in the renal cortex and MBF responses in the inner stripe of the outer medulla in anesthetized rats. Although this technique cannot measure absolute regional blood ow, it has been widely used to monitor changes in microvascular perfusion in the renal cortex and medulla in response to a given peptide or drug. Although our experimental design differed from earlier studies in several aspects (see
Fig. 5. Autoradiographs showing the effects of unlabeled ANG II (10 M) and losartan (10 M) on specic AT4 receptor binding in the rat kidney. AT4 receptors were labeled by 125 I-Nor-Leu-ANG IV, a selective agonist for ANG IV. Note that unlabeled native ANG IV (B, 10 M) and the antagonist divalinalANG IV (C, 10 M) displaced most AT4 receptor binding. AT4 receptor binding was also displaced to a signicant extent by unlabeled ANG II (D) or losartan (E, 10 M) but not by PD-123319 (F, 10 M).
below), a similar conclusion can be drawn, namely, that ANG IV might activate the AT1 receptor to induce both systemic pressor responses and intrarenal vasoconstrictor effects. In the present study, we tested the hypothesis that AT1 receptor-activated signaling mediates ANG IV-induced renal cortical vasoconstrictor responses using complementary in vivo and in vitro approaches. First, we examined the pressor and renal cortical vasoconstrictor effects of ANG IV and compared them with equimolar concentrations of its more potent precursors ANG II and ANG III in the same animal and experimental settings; moreover, the concentrations we used (0.01, 0.1, and 1 nmolkg1 min1) were comparable with those previously associated with either vasoconstriction or vasodilatation in vivo or in vitro (11, 15, 18, 19, 36). Second, pressor and renal cortical vasoconstrictor responses to ANG IV were monitored during a constant infusion rather than a single bolus injection before and after blockade of AT2 and/or AT1 receptors. We did not observe any vasodilatation response throughout ANG IV infusion before PD-123319 or losartan was administered. Instead, we observed systemic and renal
cortical vasoconstriction at two higher concentrations of ANG IV (0.1 and 1.0 nmolkg1 min1), which increased MAP and reduced renal CBF (Fig. 1). The increase in renal CBF observed after losartan administration can be attributed to AT1 receptor blockade and a tonic inuence of endogenous ANG II acting via AT1 receptors on the intrarenal microvasculature (Fig. 2). Further experiments with reverse protocols again conrmed that losartan blocked ANG IV-induced increases in MAP and reductions in renal CBF, whereas PD-123319 did not. Thus our results exclude the possibility that blockage of AT1 receptors with losartan before administration of ANG IV may uncover additional systemic and renal vasodilator effects of ANG IV. Third, to exclude the inuence of systemic factors on ANG IV-induced renal CBF responses, we infused the hexapeptide directly in the renal artery. Although intrarenal infusion of ANG IV did not alter MAP, it reduced CBF by 30%, and again the response was completely blocked by losartan (Fig. 3). Fourth, we found that unlabeled ANG IV was able to displace renal AT1 receptor binding in a concentrationdependent manner (Fig. 4), and conversely unlabeled ANG II
Fig. 7. Effects of ANG IV (10 nM) on mitogen-activated protein kinase extracellular/signal-regulated kinase (ERK) 1/2 phosphorylation in rat mesangial cells. Top: representative Western blots of phosphorylated (p-ERK1/2) and total (t-ERK1/2) ERK1/2. Bottom: semiquantitative levels of p-ERK1/2. ANG IV signicantly increased ERK1/2 phosphorylation, and the effect was blocked by losartan (10 M; n 6 each). *P 0.05, **P 0.01 vs. control. #P 0.05 vs. ANG IV.
merular VSMCs (25, 38), but it is not known whether ANG IV induces renal cortical microvascular vasoconstriction by similar intracellular mechanisms. ANG IV and its antagonist divalinal-ANG IV have been reported to activate mutant human AT1 receptors to increase intracellular IP3 accumulation in
Fig. 6. Effects of ANG IV (100 nM) on intracellular Ca2 concentration ([Ca2]i) in renal microvascular smooth muscle cells (VSMCs) determined using fura 2 ratiometric Ca2 imaging (340/380). Top: time-dependent [Ca2]i responses to ANG IV stimulation in two representative VSMCs and three other cells pretreated with losartan (10 M) before stimulation by ANG IV. Bottom: averaged peak [Ca2]i responses in renal VSMCs treated with perfusate only (time control), ANG IV, or ANG IV in the presence of losartan. Ratiometric [Ca2]i imaging (340/380) was recorded continuously at 3-s intervals for up to 10 min (n cells/group). P 0.01 vs. control (**) and vs. ANG IV ().
and losartan inhibited AT4 receptor binding to some extent (Fig. 5). Our results suggest that, even though ANG IV has less afnity for AT1 receptors than ANG II and losartan, at higher concentrations it can still compete for (or interact with) AT1 receptors to induce systemic and intrarenal effects. Indeed, a recent study shows that ANG IV is a potent agonist for AT1 receptors in CHO-K1 cells, which express mutant human AT1 receptors (28). AT1 receptor-mediated increases in [Ca2]i in response to ANG II stimulation constitute one of the most important signaling pathways in cardiovascular and renal cells (4, 12, 16, 25, 38). Previous studies have shown that ANG II increases [Ca2]i via AT1 receptor-dependent mechanisms in pregloAJP-Renal Physiol VOL
Fig. 8. Effects of inhibition of phospholipase C with U-73122 (1 M) on ANG IV-induced ERK1/2 phosphorylation in rat mesangial cells. Top: Western blots of phosphorylated and total ERK1/2. Bottom: semiquantitative levels of p-ERK1/2. ANG IV signicantly increased ERK1/2 phosphorylation, and the effect was blocked by U-73122, suggesting involvement of phospholipase C (n 6 each). **P 0.01 vs. control. ##P 0.01 vs. ANG IV. www.ajprenal.org
CHO-K1 cells (28). Increased intracellular IP3 accumulation would be expected to induce [Ca2]i responses. Handa (24) reported that both ANG IV and divalinal-ANG IV markedly increase [Ca2]i in human proximal tubule cells, but he did not clarify whether these responses were mediated by activation of AT1 receptors. In rat glomerular MCs, Chansel et al. (12) showed that at 100 nM, ANG IV does stimulate [Ca2]i, and this stimulation was completely inhibited by losartan or candesartan, suggesting that AT1 receptors are involved. The concentrations of ANG IV they used to elicit [Ca2]i responses in MCs were 10-fold higher than ANG II, but pharmacologically it behaved identically to ANG II. In the present study, we observed similar [Ca2]i responses to ANG IV stimulation in rat renal VSMCs at the concentrations used by Chansel et al. (12). Pretreatment of renal VSMCs with losartan or a PLCselective inhibitor (U-73122) effectively abolished the effects of ANG IV on [Ca2]i. Thus these results indicate that ANG IV induces renal microvascular vasoconstriction by stimulating AT1 receptors to increase [Ca2]i. In addition to inducing renal cortical microvascular constriction by increasing [Ca2]i, ANG IV also appears to mimic ANG II in activating another important AT1 receptor-mediated signal, phosphorylation of mitogen-activated protein kinase ERK1/2 in renal cortical cells (14, 16, 20, 21). We used rat glomerular MCs for the following two reasons: the difculty of obtaining sufcient amounts of protein samples from renal VSMCs for Western blot of ERK1/2 phosphorylation and the fact that renal VSMCs and MCs both express abundant AT1 receptors and respond in a similar manner to ANG II and ANG IV (12, 16, 25, 38). ANG II is well known to induce ERK1/2 phosphorylation in VSMCs via AT1 receptor activation, but it is not clear whether ANG IV has similar effects on ERK1/2 phosphorylation. Our results show that ANG IV (10 nM) was able to induce ERK1/2 phosphorylation in rat MCs, whereas pretreatment with losartan signicantly inhibited ANG IVinduced ERK1/2 phosphorylation. These actions of ANG IV are identical to ANG II (1 nM). Thus ANG IV behaves as an active agonist of ANG II by acting on AT1 receptors in rat glomerular MCs (12). The increases in mitogen-activated protein kinase ERK1/2 phosphorylation induced by ANG IV suggests that the hexapeptide may be involved in AT1 receptormediated effects of angiotensin peptides, including cell growth and proliferation in addition to intrarenal microvascular responses (29). In summary, the present study demonstrates that, at nanomolar concentrations, ANG IV can act as an active agonist of ANG II by activating AT1 receptor signaling in blood pressure regulation, renal VSMCs, and glomerular MCs. Early structure-activity studies suggest that the three NH2-terminal amino acids (Asp1-Arg2-Val3) are important for pressor activity of ANG II and its active fragments ANG III and ANG IV (2, 5, 26). Complete removal of these three amino acids abolishes the biological activities of ANG II, suggesting that ANG IV may be a minimal requirement for pressor or vasoconstrictor effects of angiotensin peptides (26, 28). Thus it is not surprising that ANG IV can compete for AT1 receptor binding sites and interact with AT1 receptors to increase blood pressure and induce constriction in various vascular beds (11, 12, 18, 19, 36). However, it should be emphasized that the pressor and renal cortical vasoconstrictor effects of ANG IV were achieved only at subnanomolar to nanomolar concentrations, which
were often 10- to 100-fold higher than those of ANG II. Therefore, for ANG IV to exert physiological or pathophysiological effects on blood pressure control and intrarenal microvascular regulation, nanomolar levels of ANG IV may be required. We have previously reported femtomolar ANG II levels in rat plasma and kidney under physiological conditions (79), which increases by severalfold during ANG II-induced hypertension (39, 44). Because ANG IV is mainly derived from the metabolism of its precursors ANG II and ANG III, its levels in the circulation and kidney unlikely reach nanomolar concentrations (6 9). Indeed, we found that the levels of ANG III and ANG IV are much lower than those of ANG II in normal rat and human plasma (79), although they may be increased signicantly after treatment with eprosartan in hypertensive humans (9). Taken together, our results suggest that ANG IV most likely plays a relatively minor role in physiological regulation of arterial blood pressure and intrarenal hemodynamics by angiotensin peptides. However, because radioreceptor binding studies have shown separate AT1 and AT4 receptors in the central nervous system and other peripheral tissues (16), ANG IV may have effects that are mediated by AT4 receptors or IRAP (2, 10, 14, 16, 17, 24, 37).
GRANTS This work was supported, in part, by National Institute of Diabetes and Digestive and Kidney Diseases Grant RO1DK-067299, American Heart Association Greater Midwest Afliate Grant-in-Aid 0355551Z, and a National Kidney Foundation of Michigan Grant-in-Aid to J. L. Zhuo. A portion of the work was supported by the National Health and Medical Research Council of Australia while J. L. Zhuo worked at the Howard Florey Institute of Experimental Physiology and Medicine, University of Melbourne, Australia (Grant No. 983001). D. J. Campbell is a recipient of Career Development Fellowship Award CR02M 0829 from the National Heart Foundation of Australia. M. Ohishi was supported by an International Research Fellowship Award from the High Blood Pressure Research Council of Australia. REFERENCES 1. Abrahamsen CT, Pullen MA, Schnackenberg CG, Grygielko ET, Edwards RM, Laping NJ, and Brooks DP. Effects of angiotensin II and IV on blood pressure, renal function, and PAI-1 expression in the heart and kidney of the rat. Pharmacology 66: 26 30, 2002. 2. Albiston AL, McDowall SG, Matsacos D, Sim P, Clune E, Mustafa T, Lee J, Mendelsohn FA, Simpson RJ, Connolly LM, and Chai SY. Evidence that the angiotensin IV [AT(4)] receptor is the enzyme insulinregulated aminopeptidase. J Biol Chem 276: 48623 48626, 2001. 3. Ardaillou R and Chansel D. Synthesis and effects of active fragments of angiotensin II. Kidney Int 52: 1458 1468, 1997. 4. Berk BC and Corson MA. Angiotensin II signal transduction in vascular smooth muscle cells: role of tyrosine kinase. Circ Res 80: 607 616, 1997. 5. Blair-West JR, Coghlan JP, Denton DA, Funder JW, and Scoggins BA. The effect of the heptapeptide (2 8) and hexapeptide (3 8) fragments of angiotensin II on aldosterone secretion. J Clin Invest 32: 575578, 1971. 6. Cain MD, Catt KJ, and Coghlan JP. Immunoreactive fragments of angiotensin II in blood. Nature 223: 617 618, 1969. 7. Campbell DJ and Kladis A. Simultaneous radioimmunoassay of six angiotensin peptides in arterial and venous plasma of man. J Hypertens 8: 165172, 1990. 8. Campbell DJ, Lawrence AC, Towrie A, Kladis A, and Valentijin AJ. Differential regulation of angiotensin peptide levels in plasma and kidney of the rat. Hypertension 18: 763773, 1991. 9. Campbell DJ, Krum H, and Murray DS. Losartan increases bradykinin levels in hypertensive humans. Circulation 111: 315320, 2005. 10. Carey RM and Siragy HM. Newly recognized components of the renin-angiotensin system: potential roles in cardiovascular and renal regulation. Endocr Rev 24: 261271, 2003. 11. Champion HC, Czapla MA, and Kadowitz PJ. Responses to angiotensin peptides are mediated by AT1 receptors in the rat. Am J Physiol Endocrinol Metab 274: E115E123, 1998. www.ajprenal.org
AT1 RECEPTOR SIGNALING AND ANG IV 12. Chansel D, Vandermeersch S, Oko A, Curat C, and Ardaillou R. Effects of angiotensin IV and angiotensin-(17) on basal and angiotensin II-stimulated cytosolic Ca2 in mesangial cells. Eur J Pharmacol 414: 165175, 2001. 13. Chansel D, Czekalski S, Vandermeersch S, Ruffet E, Fournie-Zaluski M, and Ardaillou R. Characterization of angiotensin IV-degrating enzymes and receptors on rat mesangial cells. Am J Physiol Renal Physiol 275: F535F542, 1998. 14. Chen JK, Zimpelmann J, Harris RC, and Burns KD. Angiotensin IV induces tyrosine phosphorylation of focal adhesion kinase and paxillin in proximal tubule cells. Am J Physiol Renal Physiol 280: F980 F988, 2001. 15. Coleman JK, Krebs LT, Hamilton TA, Ong B, Lawrence KA, Sardinia MF, Harding JW, and Wright JW. Autoradiographic identication of kidney angiotensin IV binding sites and angiotensin IV-induced renal cortical blood ow changes in rats. Peptides 19: 269 277, 1998. 16. de Gasparo M, Catt KJ, Inagami T, Wright JW, and Unger T. International Union of Pharmacology. XXIII. The angiotensin II receptors. Pharmacol Rev 52: 415 472, 2000. 17. Dulin N, Madhum ZT, Chang CH, Berti-Mattera L, Dickens D, and Douglas JG. Angiotensin IV receptors and signaling in opossum kidney cells. Am J Physiol Renal Fluid Electrolyte Physiol 268: F644 F652, 1995. 18. Fitzgerald SM, Evans RG, Bergstrom G, and Anderson WP. Renal hemodynamic responses to intrarenal infusion of ligands for the putative angiotensin IV receptor in anesthetized rats. J Cardiovasc Pharmacol 34: 206 211, 1999. 19. Gardiner SM, Kemp PA, March JE, and Bennett T. Regional haemodynamic effects of angiotensin II (3 8) in conscious rats. Br J Pharmacol 110: 159 162, 1993. 20. Geiger MUF, Herrero H, Zeuzem M, and Piiper A. Involvement of the platelet-derived growth factor receptor in angiotensin II-induced activation of extracellular regulated kinases 1 and 2 in human glomerular mesangial cells. FEBS Lett 472: 129 132, 2000. 21. Gorin Y, Ricono JM, Wagner B, Kim NH, Bhandari B, Choudhury GG, and Abboud HE. Angiotensin II-induced ERK1/ERK2 activation and protein synthesis are redox-dependent in glomerular mesangial cells. Biochem J 381: 231239, 2004. 22. Haberl RL, Decker PJ, and Einhaupl KM. Angiotensin degradation products mediate endothelium-dependent dilation of rabbit brain arterioles. Circ Res 68: 16211627, 1991. 23. Handa RK, Handa SE, and Elgemark MK. Autoradiographic analysis and regulation of angiotensin receptor subtypes AT4, AT1, and AT17 in the kidney. Am J Physiol Renal Physiol 281: F936 F947, 2001. 24. Handa RK. Characterization and signaling of the AT4 receptor in human proximal tubule epithelial (HK-2) cells. J Am Soc Nephrol 12: 440 449, 2001. 25. Inscho EW, Mason MJ, Schroeder AC, Deichmann PC, Stiegler KD, and Imig JD. Agonist-induced calcium regulation in freshly isolated renal microvascular smooth muscle cells. J Am Soc Nephrol 8: 569 579, 1997. 26. Khosla MC, Smeby RR, and Bumpus FM. Structure-activity relationship in angiotensin analogs. In: Handbook of Experimental Pharmacology. XXXVII. Angiotensin, edited by Page IH and Bumpus FM. Berlin: SpringerVerlag, 1974, p. 126 161. 27. Kono T, Ikeda F, Oseko F, Ohmori Y, Nakano R, Muranaka H, Taniguchi A, Imura H, Khosla MC, and Bumpus FM. Biological activity of des-asp1-des-arg2-angiotensin II in man. Acta Endocrinol (Copenh) 99: 577584, 1982.
28. Le MT, Vanderheyden PM, Szaszak M, Hunyady L, and Vauquelin G. Angiotensin IV is a potent agonist for constitutive active human AT1 receptors. Distinct roles of the N- and C-terminal residues of angiotensin II during AT1 receptor activation. J Biol Chem 277: 2310723110, 2002. 29. Li YD, Block ER, and Patel JM. Activation of multiple signaling modules is critical in angiotensin IV-induced lung endothelial cell proliferation. Am J Physiol Lung Cell Mol Physiol 283: L707L716, 2002. 30. Lochard N, Thibault G, Silversides DW, Touyz RM, and Reudelhuber TL. Chronic production of angiotensin IV in the brain leads to hypertension that is reversible with an angiotensin II AT1 receptor antagonist. Circ Res 94: 14511457, 2004. 31. Loufrani L, Henrion D, Chansel D, Ardaillou R, and Levy BI. Functional evidence for an angiotensin IV receptor in rat resistance arteries. J Pharmacol Exp Ther 291: 583588, 1999. 32. Petrescu G, Costuleanu M, Slatineanu SM, Costuleanu N, Foia L, and Costuleanu A. Contractile effects of angiotensin peptides in rat aorta are differentially dependent on tyrosine kinase activity. J Renin Angiotensin Aldosterone Syst 2: 180 187, 2001. 33. Ruan X and Arendshort WJ. Calcium entry and mobilization signaling pathways in Ang II-induced renal vasoconstriction in vivo. Am J Physiol Renal Fluid Electrolyte Physiol 270: F398 F405, 1996. 34. Skurk T, Lee YM, Rohrig K, and Hauner H. Effect of angiotensin peptides on PAI-1 expression and production in human adipocytes. Horm Metab Res 33: 196 200, 2001. 35. Swanson GN, Hanesworth JM, Sardinia MF, Coleman JK, Wright JW, Hall KL, Miller-Wing AV, Stobb JW, Cook VI, and Harding JW. Discovery of a distinct binding site for angiotensin II (3 8), a putative angiotensin IV receptor. Regul Pept 40: 409 419, 1992. 36. van Rodijnen WF, van Lambalgen TA, van Wijhe MH, Tangelder GJ, and Ter Wee PM. Renal microvascular actions of angiotensin II fragments. Am J Physiol Renal Physiol 283: F86 F92, 2002. 37. Wright JW, Krebs LT, Stobb JW, and Harding JW. The angiotensin IV system: functional implications. Front Neuroendocrinol 16: 2352, 1995. 38. Zhu Z and Arendshort WJ. Angiotensin II-receptor stimulation of cytosolic calcium concentration in cultured renal resistence arterioles. Am J Physiol Renal Fluid Electrolyte Physiol 271: F1239 F1247, 1996. 39. Zhuo JL, Ohishi M, and Mendelsohn FA. Roles of AT1 and AT2 receptors in the hypertensive Ren-2 gene transgenic rat kidney. Hypertension 33: 347353, 1999. 40. Zhuo JL, Thomas D, Harris PJ, and Skinner SL. The role of endogenous angiotensin II in the regulation of renal haemodynamics and proximal uid reabsorption in the rat. J Physiol 453: 113, 1992. 41. Zhuo JL, Song K, Abdelrahman A, and Mendelsohn FA. Blockade by intravenous losartan of AT1 angiotensin II receptors in rat brain, kidney and adrenals demonstrated by in vitro autoradiography. Clin Exp Pharmacol Physiol 21: 557567, 1994. 42. Zhuo JL, Song K, Harris PJ, and Mendelsohn FA. In vitro autoradiography reveals predominantly AT1 angiotensin II receptors in rat kidney. Renal Physiol Biochem 15: 231239, 1992. 43. Zhuo JL, Moeller I, Jenkins T, Chai SY, Allen AM, Ohishi M, and Mendelsohn FAO. Mapping tissue angiotensin-converting enzyme and angiotensin AT1, AT2 and AT4 receptors. J Hypertens 16: 20272037, 1997. 44. Zhuo JL, Imig JD, Hammond TG, Orengo S, Benes E, and Navar LG. Ang II accumulation in rat renal endosomes during Ang II-induced hypertension: role of AT1 receptor. Hypertension 39: 116 121, 2002.

Chronic kidney disease induced in mice by reversible unilateral ureteral obstruction is dependent on genetic background
Am J Physiol Renal Physiol 298:F1024-F1032, 2010. First published 20 January 2010; doi:10.1152/ajprenal.00384.2009 You might find this additional info useful. Supplemental material for this article can be found at: http://ajprenal.physiology.org/content/suppl/2010/01/21/00384.2009.DC1.html This article cites 30 articles, 6 of which can be accessed free at: http://ajprenal.physiology.org/content/298/4/F1024.full.html#ref-list-1 Updated information and services including high resolution figures, can be found at: http://ajprenal.physiology.org/content/298/4/F1024.full.html Additional material and information about AJP - Renal Physiology can be found at: http://www.the-aps.org/publications/ajprenal
Tipu S. Puri, Mohammed I. Shakaib, Anthony Chang, Liby Mathew, Oladunni Olayinka, Andrew W. M. Minto, Menaka Sarav, Bradley K. Hack and Richard J. Quigg
Downloaded from ajprenal.physiology.org on June 7, 2011
This infomation is current as of June 7, 2011.
AJP - Renal Physiology publishes original manuscripts on a broad range of subjects relating to the kidney, urinary tract, and their respective cells and vasculature, as well as to the control of body fluid volume and composition. It is published 12 times a year (monthly) by the American Physiological Society, 9650 Rockville Pike, Bethesda MD 20814-3991. Copyright 2010 by the American Physiological Society. ISSN: 0363-6127, ESSN: 1522-1466. Visit our website at http://www.the-aps.org/.
Am J Physiol Renal Physiol 298: F1024F1032, 2010. First published January 20, 2010; doi:10.1152/ajprenal.00384.2009.
Tipu S. Puri,1 Mohammed I. Shakaib,1 Anthony Chang,2 Liby Mathew,1 Oladunni Olayinka,1 Andrew W. M. Minto,1 Menaka Sarav,1 Bradley K. Hack,1 and Richard J. Quigg1
Section of Nephrology, Department of Medicine and 2Department of Pathology, University of Chicago, Chicago, Illinois
Submitted 7 July 2009; accepted in nal form 19 January 2010
Puri TS, Shakaib MI, Chang A, Mathew L, Olayinka O, Minto AW, Sarav M, Hack BK, Quigg RJ. Chronic kidney disease induced in mice by reversible unilateral ureteral obstruction is dependent on genetic background. Am J Physiol Renal Physiol 298: F1024 F1032, 2010. First published January 20, 2010; doi:10.1152/ajprenal.00384.2009. Chronic kidney disease (CKD) begins with renal injury; the progression thereafter depends upon a number of factors, including genetic background. Unilateral ureteral obstruction (UUO) is a well-described model of renal brosis and as such is considered a model of CKD. We used an improved reversible unilateral ureteral obstruction (rUUO) model in mice to study the strain dependence of development of CKD after obstruction-mediated injury. C57BL/6 mice developed CKD after reversal of three or more days of ureteral obstruction as assessed by blood urea nitrogen (BUN) measurements (40 mg/dl). In contrast, BALB/c mice were resistant to CKD with up to 10 days ureteral obstruction. During rUUO, C57BL/6 mice exhibited pronounced inammatory and intrinsic proliferative cellular responses, disruption of renal architecture, and ultimately brosis. By comparison, BALB/c mice had more controlled and measured extrinsic and intrinsic responses to injury with a return to normal within several weeks after release of ureteral obstruction. Our ndings provide a model that allows investigation of the genetic basis of events during recovery from injury that contribute to the development of CKD. renal injury; renal brosis; functional kidney disease model; strain dependence
THE EPIDEMIOLOGY OF KIDNEY
and brosis occur over a time course of days to weeks and that it can be used in mice of any strain. Our primary goal in these studies was to determine whether there were differences in the development of CKD between strains of mice. We have used an improved method of reversible unilateral ureteral obstruction (rUUO) to study strain-dependent differences in both injury and repair phases and their functional consequences. Our ndings provide a model that allows investigation of the genetic basis of events during injury and recovery that contribute to the development of CKD.
MATERIALS AND METHODS
disease reveals striking differences in incidence and prevalence rates of chronic kidney disease (CKD) and end-stage kidney disease (ESKD) between racial groups, with highest rates seen in the African-American population. The fundamental pathophysiology underlying this variability from group to group is a question of great clinical importance that remains largely unexplained. In human kidney diseases, there are often periods of injury/inammation followed by repair processes, including those induced by therapeutic maneuvers. Repair after injury may result in regeneration of renal structures and recovery of function, or may result in replacement of renal structures by nonfunctional matrix. Predominance by the latter process of destructive brosis is widely considered to be responsible for the development and progression of CKD. It seems likely that both the injury phase and the repair phase would have an underlying genetic basis, given the considerable diversity in progression of renal diseases to ESKD (1, 23). Unilateral ureteral obstruction (UUO) is a well-described model of renal brosis and as such is considered a model of CKD (13). Advantages of this model include that kidney injury
Address for reprint requests and other correspondence: T. S. Puri, Section of Nephrology, Dept. of Medicine, Univ. of Chicago, 5841 South Maryland Ave., MC5100, Chicago, IL 60637 (e-mail: tpuri@medicine.bsd.uchicago.edu). F1024
rUUO protocol. All aspects of the use of vertebrate animals in these studies were approved by the University of Chicago Institutional Animal Care and Use Committee (IACUC). Chevalier and colleagues (5, 6) have demonstrated that transient obstruction in neonatal rats leads to chronic renal insufciency in adulthood as a consequence of impaired growth, glomerular sclerosis, tubular atrophy, chronic inammation, and interstitial brosis. With older mice (12 wk), increased periureteral fat raised concerns about the reliability of obstruction by the microvascular clips and problems with adhesions due to damage to the fat. Given these considerations, 6- to 8-wk-old adult mice were used for these studies. Mice underwent anesthesia with continuous inhaled isourane, and all techniques were performed under strict aseptic conditions. After a standard laparotomy, the bowel was gently displaced from the abdomen to one side and covered with sterile saline-soaked sterile gauze. The right ureter was isolated by blunt dissection and clamped (right ureteral obstruction; RUO) with a nontraumatic microvascular clip (515 g/mm2, 7 mm S&T Vascular Clamp, Fine Science Tools, Foster City, CA). The bowel was then laid back in place. The muscle and fascia were closed with 4-0 nylon sutures, and the skin was then closed with sterile surgical wound clips. Prophylactic chlorhexidine ointment (150 l) was applied to the abdominal wound. In studies using increasing times of obstruction (Fig. 1), we noted a nearly linear inverse relationship between the time that the microvascular clip was left in one position on the ureter and the reversal rate (Supplementary Fig. 1, dotted line; all supplementary material for this article is available the journal web site). This suggested that failure of obstruction to reverse might reect progressive injury to the clamped segment of the ureter. We determined that changing the position of the clip by moving it distally every 2 days during the obstruction period greatly improved the rate of successful reversal of obstruction to 70% after a total of 6 days of obstruction compared with 20% if the clip was left in one position for 6 days (Supplementary Fig. 1). Based on this, the surgical procedure was repeated every 2 days with a microvascular clip placed immediately distal to the clipped site on the right ureter and then the proximal clip was removed. To maintain uninterrupted obstruction, the distal clip was placed on the ureter before the proximal clip was removed. Supplementary Fig. 2 graphically shows the procedure for a 6-day obstruction. After the desired total time of obstruction, the microvascular clip was removed (right ureteral obstruction release; RUOR). Placement or removal of the microvascular clip required 5 min, and total surgery time per animal from induchttp://www.ajprenal.org
0363-6127/10 $8.00 Copyright 2010 the American Physiological Society
GENETIC BASIS OF CKD AFTER REVERSIBLE UUO
Fig. 1. Development of chronic kidney disease (CKD) after varying times of ureteral obstruction followed by its reversal. C57BL/6 mice had their right ureter obstructed (RUO) for the indicated number of days followed by the release of this obstruction (RUOR), 7 days of recovery, and then removal of contralateral kidney function (left ureteral obstruction; LUO). Blood urea nitrogen (BUN) levels were measured post-LUO to assess function of the previously obstructed right kidney. C57BL/6 mice developed CKD with times of obstruction (tO) 3 days (3d) as evidenced by persistently elevated BUN levels. Development of CKD exhibited a dose-response relationship with tO. Error bars indicate SE. *P 0.03 vs. RUOR. P 0.03 vs. 3d RUO. P 0.05 vs. 5d RUO.
tion of anesthesia to close of laparotomy was 2530 min. Surgeries could be comfortably performed on animals during a typical 6to 7-h operative session. Mice tolerated the multiple surgeries without difculty as evidenced by a rapid return to normal activity (grooming, feeding, drinking, etc.) after recovery from anesthesia. There was no evidence for wound or systemic infection as a consequence of the protocol. After 7 days of recovery, reversal of obstruction was conrmed by resolution of hydronephrosis (Supplementary Fig. 3). As has also been noted by others (7, 26), the function of the normal contralateral kidney is sufcient to keep serum markers of kidney function at normal to near normal levels. Thus, after allowing a sufcient period of recovery for the previously obstructed kidney, the function of the normal contralateral kidney needed to be removed to allow evaluation of the functional consequences of obstruction-mediated injury. If contralateral kidney function was removed 1 wk after the release of the obstruction, the previously obstructed kidney had not recovered sufcient function and the majority of animals died (data not shown). Preterminal blood urea nitrogen (BUN) and serum potassium levels (SK) were 200 mg/dl and 12 meq/l, respectively, suggesting that animals died of renal failure. After 1 wk, the previously obstructed kidney had sufciently recovered to allow removal of contralateral kidney function without consequent death from renal failure. This was accomplished by a left nephrectomy (LNX) or more typically left ureteral obstruction (LUO) by ligation of the left ureter with a silk suture. No difference in function was observed with either LUO or LNX (Supplementary Fig. 4). LUO was typically used as it is a faster procedure (5 min for LUO vs. min for LNX), and it avoided a small but measurable increase in animal loss due to bleeding (5%). With the exception of the study in Supplementary Fig. 4, LUO at 7 days after relief of obstruction was used in all studies where contralateral kidney function was removed. Serum for BUN and potassium measurements was obtained by retroorbital bleeding. Urine was collected by aspiration from the bladder under anesthesia before tissue harvest. Tissue harvest. Kidneys were surgically removed under anesthesia and sectioned after removal of the renal capsule and extrarenal structures. Each kidney was sectioned along the transverse axis into three pieces: upper (3- to 4-mm length), middle (2- to 3-mm length),
AJP-Renal Physiol VOL
lower (3- to 4-mm length). The upper and lower pieces contained the upper and lower poles of the kidney. The middle piece was cut in half again along the transverse axis, and the resulting pieces (1- to 1.5-mm length/thickness each) were processed for light microscopy (as described below) or frozen in a block using Histoprep (Fisher Scientic, Fair Lawn, NJ) and stored at 80C. The upper and lower pieces were cut in half along the coronal axis, and the resulting four equal-size pieces were ash frozen in liquid nitrogen and then stored at 80C for RNA and protein studies. All pieces contained both cortex and medulla. Light microscopy. Pieces of renal tissue no more than 11.5 mm thick were xed in 4% paraformaldehyde in 1 PBS (pH 7.4) for 24 h at 4C. Following xation, tissue samples were routinely processed and embedded in parafn wax (TissuePrep II, Fisher Scientic). Tissue sections, of 5-m thickness, were cut onto SuperfrostPlus slides (Fisher Scientic), dewaxed, and hydrated through a descending series of alcohols. Tissue sections were routinely stained by Mayers hematoxylin and Putts eosin (H&E), Massons trichrome, and Sirius red. Immunohistochemistry. Immunohistochemical staining was conducted using a Vectastain Elite ABC kit (Vector Laboratories, Burlingame, CA) with some modications. Briey, 5-m sections were deparafnized, and endogenous peroxidase activity was quenched by incubation in hydrogen peroxide. Epitope retrieval was carried out on tissue sections by microwave treatment (10 min on high setting) followed by blocking for endogenous biotin and nonspecic background staining. Blocking was followed by incubation with the afnity-puried antibody [rabbit anti-mouse F4/80 antibody (sc25830; Santa Cruz, CA) or rabbit anti-mouse S100A4 (ab27957; Abcam, Cambridge, MA)] or control IgG. Sections were then washed in Tween 20-buffered saline (TBS) and incubated with biotinylated secondary antibody. After further washes with TBS, the sections were incubated with an avidin-biotinylated horseradish peroxidase complex. Finally, the sections were rewashed and developed by diaminobenzidine tetrahydrochloride (Sigma, St. Louis, MO). Staining of kidney tissue from untreated kidney or staining with nonimmune serum or rabbit IgG was performed for controls. Staining with control reagents was negative in all cases. All procedures were carried out at room temperature unless otherwise noted. Immunouorescence staining. For immunouorescence staining, 5-m frozen sections were air dried at room temperature for 30 min. Sections were xed with ice-cold acetone for 10 min, then washed with 1 PBS. Fixed sections were incubated for 1 h at room temperature in a humidied chamber with the cocktail of primary antibodies [rabbit anti-mouse S100A4 (ab27957; Abcam) and rabbit anti-mouse laminin (T40269R; Meridian Life Science, Cincinnati, OH)] preconjugated to different uorescent labels and diluted 1:100 in 1 PBS. Sections were washed three times (5 min/wash) with 1 PBS. Stained sections were stored at 4C in the dark. Flow cytometry. Single-cell suspensions of isolated renal cells were prepared from whole kidneys at the indicated time using modication of previously described methods (29). Whole kidneys were minced into small pieces (1 mm) in ice-cold 1 HBSS media. Tissue fragments were centrifuged at 250 g 5 min. Pelleted fragments were resuspended in HBSS with 1 mg/ml collagenase (type IA, catalog no. C-9891, Sigma) and 0.1 mg/ml deoxyribonuclease (DNase, type I, catalog no. DN25, Sigma) and then incubated at 37C for 25 min with gentle shaking every 5 min to disaggregate renal cells. The suspension was again centrifuged at 250 g 5 min, and the supernatant was discarded. The pellet was resuspended in 2 ml of RBC lysing reagent (150 mM NH4Cl, 10 mM KHCO3, 0.5 M EDTA, pH 8) and incubated for 5 min at room temperature. The suspension was again centrifuged at 250 g 5 min, and the supernatant was discarded. The pellet was resuspended in 12 ml of ice-cold 1 PBS. The suspension was passed through a nylon mesh (BD-Falcon 40-m self-strainer) to remove undigested fragments. Cells suspensions were stained with 0.4% trypan blue and counted using a hemocytometer. In our protocol,
www.ajprenal.org
298 APRIL 2010
Table 1. Primers for quantitative real-time PCR
Gene Accession No. Sense Primer(5=-3=) Antisense Primer (5=-3=) Product, bp
Collagen III1 S100A4
NM_009930 NM_011311
aggcaacagtggttctcctg caggcaaagagggtgacaag
gacctcgtgctccagttagc cttttccccaggaagctagg
149 88
typically live cells/ml were isolated from one whole kidney. One hundred microliters of single-cell suspensions were incubated with 11.5 l (based on the manufacturers recommendations) of the indicated uorescently labeled antibody, on ice, for 25 min in the dark (F4/80 antibody, catalog no. MCA497APC, Serotec, Raleigh, NC). Labeled cell suspensions were washed a total of two times with ice-cold 1 PBS (4 ml/wash) followed by centrifugation at 250 g 5 min to pellet cells between washes. As a nal step, cells were resuspended in ice-cold PBS and then analyzed on a ow cytometer (FACScanto, Becton-Dickinson, Franklin Lakes, NJ). Data were analyzed using FlowJo v 8.7 software. Quantitative real-time PCR. Total RNA was extracted from frozen kidneys using TRIzol Reagent (Invitrogen, Carlsbad, CA). Five micrograms of RNA from each sample were reverse transcribed according to the manufacturers protocol (Superscript III, Invitrogen). Quantitative PCR was performed utilizing the ABI 7900 HT Fast Real Time PCR System and SDS 2.3 software (Applied Biosystems, Foster City, CA). Gene-specic primers are provided in Table 1. The reaction product was quantied by monitoring the uorescence levels of the intercalating SYBR green dye. A sample of 5 l of 1:10 diluted cDNA was analyzed along with the control cDNA standard. Tubes contained 10 l of SYBR Green dye mix (QuantiTect SYBR Green PCR kit, catalog no. 204145, Qiagen, Valencia, CA), 250 nM each forward and reverse primers, 5 l of template cDNA, and water to bring all nal reaction volumes to 20 l. Reactions were monitored by conrming single reaction products by agarose gel electrophoresis, and single peaks of melting temperature curves were determined at the end of the reaction. Statistical analyses. All data were analyzed with Minitab 15 (College Park, MD) and initially evaluated by Anderson-Darling normality testing. For numeric data collected over time, values from C57BL/6 and BALB/c mice subjected to sham RUO at each time period (n 4 8) were used to normalize experimental data. Univariate ANOVA was then used to compare experimental data between the two strains; when signicantly different, follow-up comparisons at individual time points post-RUOR were made using Tukeys tests. When two groups of parametric data were compared, a two-sample t-test was used.
RESULTS
baseline levels, reecting loss of function in this kidney. BUN levels remained stable at this new baseline for times up to 6 mo (Fig. 1). Therefore, this model successfully and reliably produced CKD in mice. Strain differences in susceptibility to rUUO. In our initial work to develop the rUUO model, we noted that outbred CD-1 mice had considerable variability in development of CKD (as assessed by BUN values reecting the function of the previously obstructed kidney; data not shown), while inbred C57BL/6 mice were much more consistent in their responses. This suggested there was a genetic component to the injury and repair responses of the rUUO model. Therefore, in the next prospective experiments, we compared development of CKD in C57BL/6 mice to mice of 129 and BALB/c strains following reversal of a 6-day obstruction. In these studies, 129 mice exhibited irreversible loss of function comparable to C57BL/6 mice (data not shown), while the BALB/c strain was completely resistant to loss of function (Fig. 2). To further examine the BALB/c response to injury, we increased the durations of ureteral obstruction. Yet, even after 10 days of obstruction, the BALB/c strain remained nearly completely resistant to renal functional impairment, with nal BUN levels of 32.8 2.0 compared with baseline levels of 27.3 0.9 mg/dl (n 5). In subsequent studies, it is important to note that in the rUUO protocol the function of the contralateral unmanipulated kidney was removed 7 days after RUOR. Therefore, for time points up to and including day 7 post-RUOR, the contralateral unmanipulated kidney was in place and functional.
Irreversible loss of kidney function with increasing duration of obstruction. We investigated the development of irreversible loss of kidney function after increasing time of obstruction followed by the release of the obstruction. In normal C57BL/6 mice, renal function was dependent upon the time of obstruction, such that with 12 days of obstruction, there was full function of the obstructed kidney following removal of contralateral kidney function (Fig. 1). With ureteral obstructions of 3 or more days, there was obstruction-time dependent renal failure (Fig. 1). Immediately following the removal of contralateral (left) kidney function, there was a considerable but transient rise in BUN, which then fell and stabilized at a level elevated from baseline. The transient rise and then fall in BUN likely reects the expected shift in blood ow to the previously obstructed (right) kidney followed by hyperltration (28). Notably, compared with the contralateral (left) kidney during the initial reversible obstruction, the previously obstructed (right) kidney is not able to bring BUN levels down to previous
Fig. 2. Susceptibility to development of CKD after reversible unilateral ureteral obstruction (rUUO) in murine strains. C57BL/6 (blue lines) and BALB/c (red lines) mice underwent 6 days of RUO followed by RUOR (obstructed, solid lines) or surgical manipulation but no ureteral obstruction (sham, dashed lines). Seven days later, the contralateral left kidney function was removed (LUO), and BUN values were measured over time, as reective of the function of the previously obstructed right kidney alone. The C57BL/6 strain demonstrated signicant chronic loss of renal function after 6 days of rUUO, while the BALB/c strain was resistant to loss of function after rUUO. Error bars indicate SE. *P 0.03 vs. RUOR. P 0.02 vs. sham. P 0.05 vs. BALB/c. www.ajprenal.org
Histological features in rUUO. In the next set of studies, we examined histological features of the 6-day rUUO model and compared those in C57BL/6 and BALB/c mice at various times up to 28 days following RUOR. Representative histopathology demonstrated by H&E staining is shown in Fig. 3A. The day 0 post-RUOR time point reects events occurring after 6 days of UUO before RUOR. Scores reecting global interstitial inammation based on H&E staining were accumulated by a renal pathologist blinded to origin of slides (strain and rUUO time point). Inammation scores after 6 days of obstruction and following RUOR for each strain are shown in Fig. 3B. As is known to occur, there was considerable tubular injury after 6 days of UUO, as manifested by tubular dilatation and epithelial cell attening (and loss of brush border in the proximal segments) (Fig. 3A, day 0). In addition, interstitial inammation was readily apparent around the tubules at day 0. At this time point before RUOR, inammation was somewhat more prominent in kidneys from the C57BL/6 strain compared with those from the BALB/c strain. This observation was supported by inammation scores at day 0 (Fig. 3B). Further strain-dependent differences in the progression of inammation and alterations in tubular architecture were clearly observed post-RUOR. From 0 to 7 days post-RUOR, the C57BL/6 strain developed further inammation and tubular atrophy and interstitial brosis (as evidenced by decreased tubular lumen sizes and loss of back-to-back tubular organization) (Fig. 3A, left column). At 7 days post-RUOR, the C57BL/6 strain had remarkable cellular inltration and proliferation, particularly in the outer cortex. In kidneys from BALB/c mice, a modest increase in inammation was also observed from 0 to 2.5 days post-RUOR (Fig. 3A, right column, and B). By contrast, at 7 days post-RUOR, resolving inammation, retention of back-to-back tubular organization, and a gradual return toward normal histology was apparent in the BALB/c strain. Slight histological differences remained between strains at 28 days post-RUOR. C57BL/6 kidneys had a persistence of mild interstitial inammation associated with patchy areas of interstitial brosis around atrophic tubules, whereas BALB/c kidneys had a normal histological appearance. Assessment of interstitial brosis by histochemical staining supported these observations (see Fig. 5). Macrophage/monocyte inltration in rUUO. The pathophysiology of renal injury in the UUO model itself remains enigmatic, despite a concentrated effort by many investigators (3, 13, 16). Given the signicant cellular inltration/proliferation, we examined markers of extrinsic cellular inltration. Flow cytometry was utilized, as others have during irreversible UUO (29). To more specically characterize the signicant monocytic inltration, F4/80 cells were quantied. After RUO of 6 days, F4/80 cells were elevated in both the C57BL/6 and BALB/c strains compared with sham controls for each strain (Fig. 4A). Notably, F4/80 cells comprised a signicantly larger percentage of total isolated cells from C57BL/6 kidneys compared with BALB/c kidneys (34.6 3.3 and 21.8 1.2%, respectively, P 0.01). This relatively greater proportion of F4/80 cells in C57BL/6 compared with BALB/c obstructed kidneys persisted post-RUOR. From 0 to 2 days post-RUOR, there was a decline in F4/80 cells evident in C57BL/6 mice, while F4/80 cells in BALB/c mice remained stable. At 7 days post-RUOR, elevated numbers of F4/80 cells persisted in C57BL/6 mice. By contrast, F4/80 cells in BALB/c mice
declined to percentages similar to those seen in sham control mice of either strain at 7 days post-RUOR. In addition to their increased proportions in cellular suspensions from C57BL/6 kidneys, there were increased numbers of F4/80 cells by immunohistochemistry (Fig. 4B shows anti-F4/80 staining 7 days post-RUOR). Assessment of brosis after rUUO. To quantify chronic tubulointerstitial pathological changes, scores reecting global brosis were accumulated by a renal pathologist blinded to the origin of slides (strain and rUUO time point). Renal brosis scores reected tubular atrophy and increased interstitial matrix, as visualized with Sirius red (Fig. 5A)- and Massons trichrome-stained (not shown) sections with a range from 0 to 6. As shown in Fig. 5A, the mean brosis score at 28 days post-RUOR in C57BL/6 mice was nearly threefold higher than in BALB/c mice. Collagen III is a major component of deposited interstitial matrix that accumulates with development and progression of CKD. Collagen III 1 mRNA levels assessed by QPCR showed dramatic changes during obstruction (not shown) and after release of obstruction in both C57BL/6 and BALB/c mice (Fig. 5B). Consistent with the greater degree of brosis, C57BL/6 mice had greater collagen III (1) mRNA levels following release of UUO. Markers of epithelial-to-mesenchymal transition in rUUO. Epithelial-to-mesenchymal transition (EMT) with the resulting generation of tubulointerstitial myobroblasts is believed relevant to the development of renal brosis after injury. We examined the mRNA levels of S100A4, a potential marker of epithelial cell transformation to myobroblasts, to investigate the underlying repair processes in the rUUO model. Figure 6A shows the change in mRNA levels during recovery from obstruction compared with mRNA levels from sham-operated control mice. After 6 days of obstruction (0d RUOR time point), elevated levels of S100A4 mRNA compared with sham were observed in both strains, with levels in C57BL/6 mice double those in BALB/c. S100A4 mRNA levels continued to rise through 2.5 days post-RUOR in C57BL/6 mice and thereafter showed a modest decline. A similar time course was observed post-RUOR in BALB/c mice however, S100A4 levels were consistently lower throughout and approached sham control levels by 14 days post-RUOR. Figure 6B shows immunohistochemical staining of kidney sections at 2.5 days post-RUOR with an anti-S100A4 antibody. While S100A4 was expressed in the kidneys of both strains, it was interesting that in C57BL/6 mice it was identied between (beneath) tubules (Fig. 6B, arrows), while in BALB/c mice, it was restricted to expression in tubular cells that remained in place on the tubular basement membrane (Fig. 6B, asterisk). At later time points, these cells were shed, rather than appearing in interstitial spaces as apparent in C57BL/6 mice. To further investigate this, we performed dual immunouorescent-labeled antibody staining of kidney sections at 2.5 days post-RUOR with an anti-laminin antibody to outline the tubular basement membrane (TBM) along with anti-S100A4. Immunouorescence staining for S100A4 and laminin in Fig. 6C clearly demonstrated morphology consistent with staining of tubular epithelial cells in both strains. In sections from C57BL/6 mice, anti-laminin staining was consistent with a loss of integrity of the TBM, and S100A4 cells were observed to be traversing the TBM into the tubulointerstitial spaces (Fig. 6C, top). In
Fig. 3. Hematoxylin and eosin (H&E) staining at various times following release of ureteral obstruction. A: representative H&E-stained sections from C57BL/6 and BALB/c at various times following release of 6 days of RUO (post-RUOR; 20 magnication). In C57BL/6 mice, inammatory cells persisted through 7 days postRUOR and were accompanied by signicant and lasting disruption of tubular architecture. In BALB/c mice, inammation developed rapidly and then resolved. Tubular architecture was better preserved throughout with a return to near-normal structure by day 28 post-RUOR. B: average inammation score at 0, 2.5, 7, and 28 days post-RUOR. H&E-stained sections from C57BL/6 and BALB/c mice were scored (03) for severity of global interstitial inammation by a renal pathologist blinded to their origin (strain and rUUO time point). A score of 0 was used for absence of interstitial inammation. Scores of 1, 2, or 3 reected the presence of inammation involving 125, 2650, or 50% of the interstitium, respectively. *P 0.05 vs. BALB/c (Kruskal-Wallis test).
Fig. 4. F4/80 cellular inltration in rUUO. C57BL/6 and BALB/c mice underwent a 6 day obstruction followed by release and were studied using ow cytometry and immunohistochemistry at the indicated times postRUOR. A, top: representative ow cytometric data showing side scatter (SSC-A) vs. F4/80 staining for whole kidney cell preparations at 0, 2, and 7 days post-RUOR. Representative control data with omission of anti-F4/80 antibody (unstained) is shown at the top. Bottom: summary of percentage of F4/80 cells in whole kidney cell preparations at 0, 2, and 7 days after release of a 6-day obstruction in C57BL/6 (blue) and BALB/c (red) mice. Error bars indicate SE. Data from controls are shown for each strain (dashed lines). Controls for each strain included data from both contralateral kidneys as well as sham-operated kidneys as no difference was seen between either types of control. *P 0.01 vs. control. **P 0.05 vs. control. P 0.005 vs. BALB/c. B: kidney tissue sections stained at 7 days post-RUOR with F4/80 antibody.
contrast, anti-laminin staining in sections from BALB/c mice demonstrated preservation of TBM integrity, and S100A4 cells were conned to the intratubular space (Fig. 6C, bottom).
DISCUSSION
The ureteral obstruction model has become widely used to study renal interstitial brosis, a hallmark of development and
ureters. This approach allowed separate functional assessment of postobstructed and contralateral control kidneys; however, it is less amenable to longer term serial assessment of renal function, and a signicant number of animals were reported lost due to shredding of the ureter during the delicate cannulation procedure. Tapmeier and colleagues (26) reestablished ureteral patency by reimplantation of the ureter into the bladder and excision of the suture-ligated segment of ureter followed by contralateral nephrectomy and assessment of the postobstructed kidney function using BUN measurements. This approach allowed a longitudinal study of renal function, but reimplantation of the ureter requires an experienced animal surgeon and delicate microsurgical procedures performed while operating with a binocular microscope. Our approach to reversible ureteral obstruction in adult mice focused on minimizing injury to the ureter, thereby allowing an independent return of patency after relief of complete obstruction rather than reestablishing patency after injury. The multiple surgeries required by our protocol are extremely well tolerated by the mice with no evidence of systemic or wound infections and a rapid return to normal feeding and grooming behaviors after each surgery. Our method combines attractive features of existing approaches, including 1) the use of microvascular clips to facilitate obstruction and removal of obstruction; and 2) longitudinal assessment of renal function in the postobstructed kidney. Furthermore, it offers the advantages of utilizing simple surgical techniques that can be performed by laboratory personnel with basic technical skills and obviates the need for an experienced animal surgeon to perform delicate microsurgical procedures. Therefore, we believe this is an improved and relatively simple approach to achieve rUUO in adult mice.
Using our rUUO model, we have identied C57BL/6 mice to be susceptible and BALB/c mice to be resistant to development of CKD after obstruction-mediated injury. Here, it is important to emphasize that all mice were subjected to the exact same protocol with the only variables being 1) the omission of actual clip placement in sham animals and 2) the genetic strain of mice used. The degree of hydronephrosis was assessed by visual inspection on days 2, 4, and 6 of the surgical protocol during obstruction (Supplementary Fig. 1). No differences in the degree of hydronephrosis were observed between strains based on these repeated assessments of all mice reported in this study. Published reports of differences in susceptibility or resistance between inbred mouse strains in models of kidney disease are limited. Strain dependence of susceptibility or resistance to development of glomerulosclerosis has been reported in mouse models using genetic mutations to reduce nephron number and the nephrectomy model (9, 15, 31). Strain dependence has also been reported in an experimental model of human focal glomerular sclerosis using adriamycin-induced nephropathy. In this model, BALB/c mice were susceptible to development of chronic proteinuric renal disease after adriamycin injection while C57BL/6 mice were found to be resistant (12, 30). As expected, major histological ndings in our studies were predominantly in the tubulointerstitial compartment with no signicant ndings in the glomeruli in mice of either strain. Consistent with this, we found no signicant change in proteinuria throughout the rUUO protocol between experimental and sham animals or between strains (Supplementary Fig. 5). To our knowledge, ours is the rst report of a difference in susceptibility to loss of renal function and the development of tubulointerstitial brosis after injury, which is considered to be a hallmark of development and progression of CKD. Thus it provides a powerful model in which to dissect the genetic basis of susceptibility or resistance to development and progression of CKD. Such studies have major relevance to public health and human disease. Inammation is appreciated as a highly regulated process that is designed to restore normal function after injury with minimal tissue damage. As is known to occur in UUO, we observed tubular dilatation, epithelial cell attening, and inammation during the phase of obstruction (28). Our results also demonstrated that the extent of inammation during the obstruction phase of injury and during recovery from injury was signicantly different among the different strains, suggesting that the extent or resolution of injury/inammation might account for the differences in susceptibility and resistance we observed. Of the inammatory cells, F4/80 cells of monocytic lineage were the most prominent in both strains as expected (14, 24). The pattern of F4/80 cell inltration demonstrated intriguing differences between the two strains (Fig. 4A). Further investigation will be necessary to determine the potential signicance of these ndings along with the specic types of F4/80 cells involved, which may include dendritic cells as well as macrophages. It is largely held that CKD occurs as a consequence of the process of destructive brosis. UUO is a well-described model of renal brosis and as such is considered a model of CKD. Histopathologically, there was a strong correlation between the degree of interstitial brosis and renal functional loss at the later time
points post-RUOR. Consistent with this was the considerably upregulated expression of collagen III (1) mRNA in C57BL/6 mice. Epithelial cell injury, as a consequence of obstruction or otherwise, results in induction of EMT and local broblast generation (11, 18). Many studies have highlighted the potential role of EMT in the development of brosis after kidney injury (8, 11, 25). We have demonstrated intriguing differences between strains in mRNA expression and immunohistochemistry of S100A4, a potential marker of EMT, during recovery from obstruction. These ndings suggest that differential induction of EMT and/or associated downstream events might have an important role in susceptibility or resistance to development of brosis and CKD and warrant further investigation. Based on our data, the mechanism by which myobroblasts gain access to the tubulointerstitial space, including the identity and activity of specic matrix-degrading enzymes, would be a particular area of focus. In summary, we have identied inbred strains of mice that are either susceptible (C57BL/6) or resistant (BALB/c) to development of CKD after rUUO. Our impression is that the extrinsic and intrinsic responses to injury are more controlled and measured in the BALB/c mice with rUUO. Either contributing to this or as a consequence, renal architecture is better maintained throughout injury and recovery from injury. In contrast, the response to injury in C57BL/6 mice is more pronounced and prolonged with rUUO. Conrmation and further investigation of these observations are necessary and will be the focus of future work with this model. Strain-dependent differences in inammatory and tubular cell responses during the injury and recovery/repair phases provide intriguing potential targets for further studies of susceptibility or resistance to the development of CKD.
ACKNOWLEDGMENTS We thank Ryan Duggan for his expert technical assistance with the ow cytometry studies. We thank Brian Mack for work during the early development of the rUUO surgical protocol. GRANTS This work was supported by National Institutes of Health Grants R01DK041873, R01DK055357, T32DK007510, and T32HL07381, and a Young Investigator Award from the National Kidney Foundation of Illinois and an Early Career Award from the Howard Hughes Medical Institute to T. S. Puri. DISCLOSURES No conicts of interest are declared by the authors. REFERENCES 1. Bonventre JV. Pathophysiology of acute kidney injury: roles of potential inhibitors of inammation. Contrib Nephrol 156: 39 46, 2007. 2. Chan W, Krieg RJ Jr, Ward K, Santos F Jr, Lin KC, Chan JC. Progression after release of obstructive nephropathy. Pediatr Nephrol 16: 238 244, 2001. 3. Chevalier RL. Pathogenesis of renal injury in obstructive uropathy. Curr Opin Pediatr 18: 153160, 2006. 4. Chevalier RL, Forbes MS, Thornhill BA. Ureteral obstruction as a model of renal interstitial brosis and obstructive nephropathy. Kidney Int 75: 11451152, 2009. 5. Chevalier RL, Thornhill BA, Chang AY. Unilateral ureteral obstruction in neonatal rats leads to renal insufciency in adulthood. Kidney Int 58: 19871995, 2000. 6. Chevalier RL, Thornhill BA, Wolstenholme JT, Kim A. Unilateral ureteral obstruction in early development alters renal growth: dependence on the duration of obstruction. J Urol 161: 309 313, 1999. www.ajprenal.org
GENETIC BASIS OF CKD AFTER REVERSIBLE UUO factor-beta, type IV collagen, and plasminogen activator inhibitor-1 mRNA are decreased after release of unilateral ureteral obstruction. Tohoku J Exp Med 197: 159 168, 2002. Park KM, Kramers C, Vayssier-Taussat M, Chen A, Bonventre JV. Prevention of kidney ischemia/reperfusion-induced functional injury, MAPK and MAPK kinase activation, and inammation by remote transient ureteral obstruction. J Biol Chem 277: 2040 2049, 2002. Purkerson ML, Klahr S. Protein intake conditions the diuresis seen after relief of bilateral ureteral obstruction in the rat. Proc Soc Exp Biol Med 177: 6268, 1984. Schainuck LI, Striker GE, Cutler RE, Benditt EP. Structural-functional correlations in renal disease. II. The correlations. Hum Pathol 1: 631641, 1970. Serhan CN, Savill J. Resolution of inammation: the beginning programs the end. Nat Immunol 6: 11911197, 2005. Soos TJ, Sims TN, Barisoni L, Lin K, Littman DR, Dustin ML, Nelson PJ. CX3CR1 interstitial dendritic cells form a contiguous network throughout the entire kidney. Kidney Int 70: 591596, 2006. Strutz FM. EMT and proteinuria as progression factors. Kidney Int 75: 475481, 2009. Tapmeier TT, Brown KL, Tang Z, Sacks SH, Sheerin NS, Wong W. Reimplantation of the ureter after unilateral ureteral obstruction provides a model that allows functional evaluation. Kidney Int 73: 885889, 2008. Thornhill BA, Forbes MS, Marcinko ES, Chevalier RL. Glomerulotubular disconnection in neonatal mice after relief of partial ureteral obstruction. Kidney Int 72: 11031112, 2007. Vaughan ED Jr, Marion D, Poppas DP, Felsen D. Pathophysiology of unilateral ureteral obstruction: studies from Charlottesville to New York. J Urol 172: 25632569, 2004. Vielhauer V, Anders HJ, Perez de LG, Luckow B, Schlondorff D, Mack M. Phenotyping renal leukocyte subsets by four-color ow cytometry: characterization of chemokine receptor expression. Nephron Exp Nephrol 93: e63, 2003. Wang Y, Wang YP, Tay YC, Harris DC. Progressive adriamycin nephropathy in mice: sequence of histologic and immunohistochemical events. Kidney Int 58: 17971804, 2000. Zheng F, Striker GE, Esposito C, Lupia E, Striker LJ. Strain differences rather than hyperglycemia determine the severity of glomerulosclerosis in mice. Kidney Int 54: 1999 2007, 1998.
7. Cochrane AL, Kett MM, Samuel CS, Campanale NV, Anderson WP, Hume DA, Little MH, Bertram JF, Ricardo SD. Renal structural and functional repair in a mouse model of reversal of ureteral obstruction. J Am Soc Nephrol 16: 36233630, 2005. 8. Grande MT, Lopez-Novoa JM. Fibroblast activation and myobroblast generation in obstructive nephropathy. Nat Rev Nephrol 5: 319 328, 2009. 9. He C, Esposito C, Phillips C, Zalups RK, Henderson DA, Striker GE, Striker LJ. Dissociation of glomerular hypertrophy, cell proliferation, and glomerulosclerosis in mouse strains heterozygous for a mutation (Os) which induces a 50% reduction in nephron number. J Clin Invest 97: 12421249, 1996. 10. Ito K, Chen J, El CM, Stern JM, Seshan SV, Khodadadian JJ, Richardson I, Hyman MJ, Vaughan ED Jr, Poppas DP, Felsen D. Renal damage progresses despite improvement of renal function after relief of unilateral ureteral obstruction in adult rats. Am J Physiol Renal Physiol 287: F1283F1293, 2004. 11. Kalluri R, Neilson EG. Epithelial-mesenchymal transition and its implications for brosis. J Clin Invest 112: 1776 1784, 2003. 12. Kimura M, Takahasi H, Ohtake T, Sato T, Hishida A, Nishimura M, Honda N. Interstrain differences in murine daunomycin-induced nephrosis. Nephron 63: 193198, 1993. 13. Klahr S, Morrissey J. Obstructive nephropathy and renal brosis. Am J Physiol Renal Physiol 283: F861F875, 2002. 14. Kruger T, Benke D, Eitner F, Lang A, Wirtz M, Hamilton-Williams EE, Engel D, Giese B, Muller-Newen G, Floege J, Kurts C. Identication and functional characterization of dendritic cells in the healthy murine kidney and in experimental glomerulonephritis. J Am Soc Nephrol 15: 613621, 2004. 15. Ma LJ, Fogo AB. Model of robust induction of glomerulosclerosis in mice: importance of genetic background. Kidney Int 64: 350 355, 2003. 16. Misseri R, Rink RC, Meldrum DR, Meldrum KK. Inammatory mediators and growth factors in obstructive renal injury. J Surg Res 119: 149 159, 2004. 17. Morrissey J, Hruska K, Guo G, Wang S, Chen Q, Klahr S. Bone morphogenetic protein-7 improves renal brosis and accelerates the return of renal function. J Am Soc Nephrol 13, Suppl 1: S14 S21, 2002. 18. Neilson EG. Mechanisms of disease: broblastsa new look at an old problem. Nat Clin Pract Nephrol 2: 101108, 2006. 19. Ogata Y, Ishidoya S, Fukuzaki A, Kaneto H, Takeda A, Ohyama C, Orikasa S, Arai Y. Upregulated expression of transforming growth
Tags
GR-M492YLY CA-5AII Maestro 4200 CT-S830S SGH-A707C ERE3500 TL-C11 WRT54G F5D8235ed4 TXP37C2E VE-20 Z5530 S23 S800 Player RM-V310A AT640 KV-29FX66E DDW-F30A DVD-HR720P Ed VR KR753K RF267abwp XAA Pentax MZ-L Shot 80U NF-1A CDX-CA650X 14SH654 SU-A900D QB516K Olympus C-1 VT 6041 CV-P10NC Wedge 6 0 Gloss LRM WF-T452 1 GB Beveled Face Spectrum DI HDR230 MP-C951 MCM772 BH-212 Drive UE40C7000WW AV-R720 Deskpro EC R-230EW PG191 DRX6675Z IS-DVD100121 KDL-46Z4500 EDD2400 LH IP 400 KX-P3196 KDV 500 Recon 2 Taurus X LP-7700 Impreza STI AW2147S 84 T MIT CD VGN-SZ340P 29FS2ANX Power864 HBN5055AUC TX-SR576 OT-C635 DEH-P2600R LAM-Z10 Fitness KDL-40P5600 Recorder 80 MIC2200 ARM165-207 DVX350 Hkts 15 Ux-510 Avic-x1r Lancer UE46B6000VP Review PPD01 7020S SU-X999 20PFL3403 DPL5000 AD2022 Router RM106A Navigon 2110 HC-670 UV617 Hicom 150E 42PT8 Rogue DMR-E75VP DCR-DVD703E AV-29WX11
manuel d'instructions, Guide de l'utilisateur | Manual de instrucciones, Instrucciones de uso | Bedienungsanleitung, Bedienungsanleitung | Manual de Instruções, guia do usuário | инструкция | návod na použitie, Užívateľská príručka, návod k použití | bruksanvisningen | instrukcja, podręcznik użytkownika | kullanım kılavuzu, Kullanım | kézikönyv, használati útmutató | manuale di istruzioni, istruzioni d'uso | handleiding, gebruikershandleiding
Sitemap
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101







