LG LV901
About LG LV901Here you can find all about LG LV901 like manual and other informations. For example: review.
LG LV901 manual (user guide) is ready to download for free.
On the bottom of page users can write a review. If you own a LG LV901 please write about it to help other people. [ Report abuse or wrong photo | Share your LG LV901 photo ]
Manual
Preview of first few manual pages (at low quality). Check before download. Click to enlarge.
Download
(German)LG LV901, size: 7.0 MB |
LG LV901
User reviews and opinions
No opinions have been provided. Be the first and add a new opinion/review.
Documents

Color Video Camera Instruction Manual
Models : LV903 LV902 LV901
Before installing, operating or adjusting this product, please read this instruction booklet carefully and completely.
RISK OF ELECTRIC SHOCK DO NOT OPEN CAUTION: TO REDUCE THE RISK OF ELECTRIC SHOCK DO NOT REMOVE COVER (OR BACK) NO USER-SERVICEABLE PARTS INSIDE REFER SERVICING TO QUALIFIED SERVICE PERSONNEL. This lightning flash with arrowhead symbol within an equilateral triangle is intended to alert the user to the presence of uninsulated dangerous voltage within the products enclosure that may be of sufficient magnitude to constitute a risk of electric shock to persons. The exclamation point within an equilateral triangle is intended to alert the user to the presence of important operating and maintenance (servicing) instructions in the literature accompanying the product. FCC WARNING: This equipment may generate or use radio frequency energy. Changes or modifications to this equipment may cause harmful interference unless the modifications are expressly approved in the
CAUTION
instruction manual. The user could lose the authority to operate this equipment if an unauthorized change or modification is made. REGULATORY INFORMATION: FCC Part 15 This equipment has been tested and found to comply with the limits for a Class A digital device, pursuant to Part 15 of the FCC Rules. These limits are designed to provide reasonable protection against harmful interference when the equipment is operated in a commercial environment. This equipment generates, uses, and can radiate radio frequency energy and, if not installed and used in accordance with the instruction manual, may cause harmful interference to radio communications. Operation of this equipment in a residential area is likely to cause harmful interference in which case the user will be required to correct the interference at his own expense. A suitable conduit entries, knock-outs or glands shall be provided in the cable entries of this product in the end user. Caution: Danger of explosion if battery is incorrectly replaced. Replaced only with the same or equivalent type recommended by the manufacturer. Dispose of used batteries according to the manufacturers instructions.
Holes in metal, through which insulated wires pass, shall have smooth well rounded surfaces or shall be provided with brushings.
Warning: Do not install this equipment in a confined space such as a bookcase or similar unit. Warning: Wiring methods shall be in accordance with the National Electric Code, ANSI/NFPA 70. Warning: This is a class A product. In a domestic environment this product may cause radio interference in which case the user may be required to take adequate measures. Warning: To reduce a risk of fire or electric shock, do not expose this product to rain or moisture. Caution: This installation should be made by a qualified service person and should conform to all local codes. Caution: To avoid electrical shock, do not open the cabinet. Refer servicing to qualified personnel only. Caution: The apparatus shall not be exposed to water (dripping or splashing) and no objects filled with liquids, such as vases, shall be placed on the apparatus. To disconnect power from the mains, pull out the mains cord plug. When install the product, ensure that the plug is easily accessible.
Disposal of your old appliance 1. When this crossed-out wheeled bin symbol is attached to a product it means the product is covered by the European Directive 2002/96/EC. 2. All electrical and electronic products should be disposed of separately from the municipal waste stream via designated collection facilities appointed by the government or the local authorities. 3. The correct disposal of your old appliance will help prevent potential negative consequences for the environment and human health. 4. For more detailed information about disposal of your old appliance, please contact your city office, waste disposal service or the shop where you purchased the product. This product is manufactured to comply with EMC Directive 2004/108/EC and Low Voltage Directive 2006/95/EC. European representative :
LG Electronics Service Europe B.V. Veluwezoom 15, 1327 AE Almere, The Netherlands (Tel : +31-036-547-8940)
Important Safety Instructions
Read these instructions. Keep these instructions. Heed all warnings. Follow all instructions. Do not use this apparatus near water. Clean only with dry cloth. Do not block any ventilation openings. Install in accordance with the manufacturer's instructions. 8. Do not install near any heat sources such as radiators, heat registers, stoves, or other apparatus (including amplifiers) that produce heat. 9. Do not defeat the safety purpose of the polarized or grounding-type plug. A polarized plug has two blades with one wider than the other. A grounding type plug has two blades and a third grounding prong. The wide blade or the third prong are provided for your safety. If the provided plug does not fit into your outlet, consult an electrician for replacement of the obsolete outlet. 10.Protect the power cord from being walked on or pinched particularly at plugs, convenience receptacles, and the point where they exit from 1. 2. 3. 4. 5. 6. 7. the apparatus. 11.Only use attachments/accessories specified by the manufacturer. 12.Use only with the cart, stand, tripod, bracket, or table specified by the manufacturer, or sold with the apparatus. When a cart is used, use caution when moving the cart/apparatus combination to avoid injury from tip-over.
13.Unplug this apparatus during lightning storms or when unused for long periods of time. 14.Refer all servicing to qualified service personnel. Servicing is required when the apparatus has been damaged in any way, such as powersupply cord or plug is damaged, liquid has been spilled or objects have fallen into the apparatus, the apparatus has been exposed to rain or moisture, does not operate normally, or has been dropped.
Contents
Features . 6 Cautions for Safe Operation. 7 Part Names and Functions. 8 Connections.10 Disassembly of the camera. 11 Installation. 12 Image Adjustment. 13 Menu Operation. 15 Camera Identification Settings . 17 Exposure Settings. 18 White Balance Settings. 22 Day/Night Setting . 24 Motion Detection Setting. 25 3D-DNR Setting. 26 Privacy Setting . 27 Special Menu Settings.28 Reset Settings. 33 Specifications . 34
Features
This color video camera is designed for use in monitoring system. Day and Night Function (IR Cut Filter) Optical x2 varifocal lens 540 TV lines of horizontal resolution High sensitivity with a minimum scene illumination of 0.0002 lux (Sens-Up, F1.2) BLC covers various light conditions Excellent signal-to-noise ratio of 50 dB Internal / Line Lock (External) Built in varifocal and DC (Auto) iris lens Weather Proof: IP66 Rating (Caution: This camera is designed for indoor installation. Do not install it outdoors.) Power Supply : Automatically switch between DC 12 V and AC 24 V Line Lock when using AC 24V. Dome Cover : Vandal -Proof
Features Chart
This table shows the differences between the models. Use LV903 is used for the description, operation and details provided in this operating guide. Models LV903P-B LV902P-B LV901P-B LV903N-B LV902N-B LV901N-B WDR Yes Yes No Yes Yes No Sens-up Yes No Yes Yes No Yes HSBLC Yes No Yes Yes No Yes
Cautions for Safe Operation
Power Supply
This camera must always be operated a AC 24V or DC 12V Certified/Listed, class 2 power supply only. Note: Be careful of AC frequency when the camera is operated with Line lock mode.
Operating and storage location
Avoid viewing a very bright object (such as light fittings) during an extended period. Avoid operating or storing the unit in the following locations. Extremely hot or cold places (operating temperature -10C ~ 50C, however, we recommend that the unit be used within a temperature range of 0C ~ 45C) Damp or dust place Places exposed to rain Places subject to strong vibration Close to generators of powerful electromagnetic radiation such as radio or TV transmitters.
Handling of the unit
Be careful not to spill water or other liquids on the unit. Be cautions not to get combustible or metallic material inside the body. If used with foreign matter inside, the camera is liable to fail or to get cause of fire or electric shock. Remove dust or dirt on the surface of the lens with a blower. Use a dry soft cloth to clean the body. If it is very dirty, use a cloth dampened with a small quantity of neutral detergent, then wipe dry. Avoid the use of volatile solvents such as thinners, alcohol, benzene, and insecticides. They may damage the surface finish and/or impair the operation of the camera.
Part Names and Functions
a bc d a Lens b Azimuth adjuster Adjusts the azimuth angle to obtain a level image. c Lens Cover Hooker Use to separate the Lens Cover. d Pan lock screw Fixes the panning position after adjusting. e Fall Prevention Wire Fixes the wire into the dome cover. f Video Out connector Use this jack for checking the picture with portable monitor when install the camera. g Buttons for menu To set items on the MENU, use the these buttons.
h Dome Cover Ring h i Dome Cover j Lens Cover k Tilting lock screw Fixes the tilting position after adjusting. i l Video output connector (BNC type) m Power input connector Supplies AC 24V or DC 12V from an external power source. o k p n Camera mounting bracket This bracket is supplied for ceiling installation. o Focus lock lever Fixes the focus position after adjusting. p Zoom lock lever Fixes the zoom position after adjusting.
Connections
Basic connection
BNC plug The peripheral devices (VCR, monitor, lens, etc.), AC adapter and cables are not supplied. 1. Connecting the monitor Make the video signal connection between the camera and the monitor or time lapse VCR. 2. Supply AC 24V or DC 12V from an external power source.
AC 24V / DC 12V cable for Camera
Video Out Connector for installer
Disassembly of the camera
1. Remove the dome cover ring by using the bit. 2. Remove the dome cover by loosening three tamper-proof screws using the supplied bit.
Installation
Mounting the Camera without bracket
This camera can be installed directly on the surface of the wall or ceiling without bracket. Use this pad to install the camera on the bumpy surface.
"A"
Mounting the Camera with bracket
This camera can be installed on the surface of the wall or ceiling using the supplied bracket.
EN FR ON T CLO SE
"B"
A Before installing the camera, make sure the arrow marks are facing to the direction that you desired to take a picture.
B Fix the screw to fix the camera body and bracket.
FR ONT
Bottom of the camera
Image Adjustment
You can manually adjust the pan/tilt/azimuth angles, focus, and zoom while observing the connected monitor. Notes: Do not hold the camera by lens unit to adjust panning, tilting, or azimuth. The video output to the BNC will be interrupted while a portable monitor is connected to the video jack. Adjust the pan/tilt position of the camera to face the place that you wish to watch. Tighten the screws after adjusting.
1. Connect a portable monitor to the video jack.
2. Adjust the pan/tilt position of the camera. Loosen the tilting lock screw. Loosen the pan lock screws. (1/4 turning)
(2) (3) (1)
3. Adjust the azimuth angle. Zoom lock lever Release the screw (1) locking the azimuth. Rotate the lens cover (3) to obtain an angle. Fix the screw locking the azimuth. Push the lens cover releaser (2). Rotate the lens cover (3) counterclockwise. Unlock the zoom lever. Move the lever to adjust the zoom. Lock the lever. Unlock the focus lever. Move the lever to adjust the focus. Lock the lever.
4. Remove the lens cover. Focus lock lever
5. Adjust the zoom
6. Adjust the focus
7. Attach the lens cover.
Menu Operation
This camera utilizes an on-screen user MENU. To set items on the menu, use the following buttons. UP button: Moves the cursor upwards. Use this button to select an item or adjust the parameters. DOWN button: Moves the cursor downwards. Use this button to select an item or adjust the parameters. RIGHT button: Moves the cursor to the right. Use this button to select or adjust the parameters of the selected item. The parameter changes each time this button is pressed. LEFT button: Moves the cursor to the left. Use this button to select or adjust the parameters of the selected item. The parameter changes each time this button is pressed. SET button: Executes selections and displays a submenu for an item with the mark.
SET UP
General Operation
1. Press [SET] button. The setup menu screen appears on the monitor. 5. Select [EXIT] option then press [SET] to exit the setup menu. In the submenu, use [UP] or [DOWN] button to select the [EXIT] then use [LEFT] or [RIGHT] button to select a mode and press [SET] to exit the setup menu. RET: Return to the previous. TOP: Return to the CAMERA SETTING menu screen. END: Exit the setup menu.
2. Use [UP] or [DOWN] button to select an option then press [SET] button. Submenu appears on the monitor. 3. Use [UP] or [DOWN] button to select a submenu option. 4. Use [LEFT] or [RIGHT] button to select a value.
Camera Identification Settings
You can use the camera identification (CAMERA ID) to assign a number to the camera.
1. Select [CAMERA ID] option on the [CAMERA SETTING] menu. 2. Use [LEFT] or [RIGHT] to select a CAMERA ID (OFF, 1-255).
Exposure Settings
You can set the exposure options using the EXPOSURE menu. Select [EXPOSURE] option on the [CAMERA SETTING] menu. Press [SET] button and the EXPOSURE menu appears.
WDR/BLC setting
Use WDR/BLC option to set the options for BLC or WDR camera.
1. Select [WDR/BLC] option. 2. Use [LEFT] or [RIGHT] button to select a mode then press [SET]. WDR: Set the WDR limit. - WDR LIMIT: LOW y MIDDLE y HIGH BLC: Set the BLC limit. - BLC LIMIT: LOW y MIDDLE y HIGH
HSBLC: Use for making objects clear and obvious by suppressing highlight. The HSBLC mode is automatically activated only in low luminance scene. - AREA SETTING: Use [LEFT] or [RIGHT] button to select a area then use [UP] or [DOWN] button to select a ON or OFF. Press [SET] to exit the Area setting menu. GRAY SCALE: Use [LEFT] or [RIGHT] button to select a gray scale. (GRAYyD.GRAYyBLACK). USER SCALE: Use [LEFT] or [RIGHT] button to select a bright level.(5 level) MASK: Use [LEFT] or [RIGHT] button to select [ON] or [OFF]. If you set the MASK to ON, the mask function is activate only when the HSBLC is automatically activated in low luminance scene. 1. Select [BRIGHTNESS] option. 2. Use [LEFT] or [RIGHT] button to set the bright level.
Brightness setting
You can set the brightness level. (0-100)
AGC (Automatic Gain Control) setting
If the images are too dark, change the maximum [AGC] value to make the images lighter.
SHUTTER (Shutter Speed) setting
1. Select [SHUTTER] option. 1. Select [AGC] option. 2. Use [LEFT] or [RIGHT] button to select a mode. (OFFy LOWyMIDDLEyHIGH) 2. Use [LEFT] or [RIGHT] button to set shutter speed. (AUTOy OFF y A.FLK y 1/160 ~ 1/90000 y x512~x2)
SENS-UP setting
If pictures are not clear due to darkness, use for increase the sensitivity of picture. Note: If you set to one of the SHUTTER options except AUTO on the [SHUTTER] menu, the [SENS-UP] setting is not available and [---] mark is displayed.
1. Use [UP] or [DOWN] button to select [SENS-UP] option. 2. Use [LEFT] or [RIGHT] button to select a [AUTO]. To setting the [AUTO] function, select the [AUTO] on the [SHUTTER]. 3. Press [SET] and use [LEFT] or [RIGHT] button to set the SENS-UP limit (x2 ~ x128).
White Balance Settings
Setting the WB (White Balance) Mode
You can select one of three modes for white balance adjustment. 1) The color temperature is out of the 1700 - 11000K range. 2) When the scene contains mostly high color temperature objects, such as a blue sky or sunset. 3) When the scene is dim. AWCbPUSH: If you select the AWCbPUSH mode, you will be able to set up the White Balance automatically using [SET] button. MANUAL: You can set the white balance options manually.
1. Select [WHITE BAL] option. 2. Use [LEFT] or [RIGHT] button to select one of three modes for white balance then press [SET]. ATW (Auto-Tracing White Balance): The color temperature range for the proper white balance is approximately 1700 - 11000K. Proper white balance may not be obtained under the following conditions:
- COLOR TEMP: Use [LEFT] or [RIGHT] button to select a funtion. (INDOOR: 3200, OUTDOOR: 5100) RED: Obtains the optimum amount of red gain. BLUE: Obtains the optimum amount of blue gain. - -
Day/Night Setting
Note: If you set the AGC to [OFF] or the SHUTTER is set to one of the SHUTTER options except AUTO on the [EXPOSURE] menu, the AUTO mode of the DAY/NIGHT function is not available and [---] mark is displayed. 1. Select [DAY/NIGHT] option. 2. Use [LEFT] or [RIGHT] button to select mode for day/night function. AUTO: You will be able to change the Day/ Night mode automatically. - LEVEL: Use [LEFT] or [RIGHT] button to select a level. (LOWyMIDDLEyHIGH) DWELL TIME: Use [LEFT] or [RIGHT] button to select a dwell time. (5, 10, 15, 30, 60 sec.) DAY: Color mode enabled. NIGHT: Black-and-white mode enabled.
Motion Detection Setting
The motion detection detects the moving objects in the scene by monitoring changes in brightness level. You can select the level of sensitivity for motion detection to 4 zone. 5. Use [UP] or [DOWN] to select an option then use [LEFT] or [RIGHT] button to adjust the option. HEIGHT: Enlarge or decrease the vertical size of the mask. WIDTH: Enlarge or decrease the horizontal size of the mask. MOVE X: Moves horizontal position of the mask. MOVE Y: Moves vertical position of the mask.
1. Select [MOTION DET] option. 2. Use [LEFT] or [RIGHT] button to select a [ON] and press [SET]. The MOTION DETECTION menu appears. 3. Use [LEFT] or [RIGHT] button to select a zone number (AREA1 ~ AREA4) on the [ZONENUMBER]. 4. Use [LEFT] or [RIGHT] button to set up the ON or OFF on the ZONE STATE.
6. Use [SENSITIVITY] option to obtain the optimum detection level.
3D-DNR Setting
1. Select [3D-DNR] option. If pictures are not clear due to brightness, use for reduce the noise of picture. 2. Use [LEFT] or [RIGHT] button to select a option. (OFFyLOWyMIDDLEyHIGH) Notes: If you set the AGC to [OFF] on the [EXPOSURE] menu, the [3D-DNR] function is not available and [---] mark is displayed. When you use this function, the afterimage may occur.
Privacy Setting
This function is aiming at the protection of personal privacy, selecting a screen part black not to be displayed in the screen. Up to 8 zones can be registered. 3. Use [LEFT] or [RIGHT] button to select a mask (AREA1 ~ AREA8) on the [MASK NUMBER]. 4. Use [LEFT] or [RIGHT] button to set up the ON or OFF on the DISPLAY option. 5. Use [LEFT] or [RIGHT] button to set up the GRAY, WHITE or BLACK on the COLOR option. 6. Use [UP] or [DOWN] to select an option then use [LEFT] or [RIGHT] button to adjust the option. 1. Select [PRIVACY] option. 2. Use [LEFT] or [RIGHT] button to select a [ON] and press [SET]. The PRIVACY SETUP menu appears. HEIGHT: Enlarge or decrease the vertical size of the mask. WIDTH: Enlarge or decrease the horizontal size of the mask. MOVE Y: Moves vertical position of the mask. MOVE X: Moves horizontal position of the mask.
Special Menu Settings
This menu lets you adjust and set up D-ZOOM, D-EFFECT, SHARPNESS, STABILIZER, COLOR, SYNC, USER TITLE, LANGUAGE function by yourself in the SPECIAL menu.
1. Select [D-ZOOM] option on the [SPECIAL] menu. 2. Use [LEFT] or [RIGHT] button to select a [ON] then press [SET] the DIGITAL ZOOM menu appears. When you set to ON, the displayed image can be shaking. 3. Use [UP] or [DOWN] to select a option then use [LEFT] or [RIGHT] button to select a level. - ZOOM: Use [LEFT] or [RIGHT] button to enlarge the screen. PAN: Use [LEFT] or [RIGHT] button to move the screen. (left or right) TILT: Use [LEFT] or [RIGHT] button to move the screen. (up or down)
1. Select [SPECIAL] option. 2. Press [SET] button and the SPECIAL menu appears.
Setting the D-ZOOM (Digital Zoom ) level
You can select the digital zoom level.
Setting the D-EFFECT (Digital effect)
You can select the digital effect.
Setting the SHARPNESS effect
You can select the sharpness effect.
1. Select [D-EFFECT] option on the [SPECIAL] menu. 2. Use [LEFT] or [RIGHT] button to select a digital effect. V-FLIP: Flip the picture vertically. MIRROR: Turn on the mirror effect. ROTATE: Rotate the picture. (180) OFF: Turn off the digital effect.
1. Select [SHARPNESS] option on the [SPECIAL] menu. 2. Use [LEFT] or [RIGHT] button to change a adjust the option.
Stabilizer setting Setting the COLOR effect
You can select the color effect.
The image stabilizer function minimizes the appearance of shaky images caused by low-frequency vibration. This function is useful for outdoor surveillance. Select [STABILIZER] option and set to ON or OFF. Note: If you set the [STABILIZER] to ON, the Digital zoom is set to [x1.1] automatically.
1. Select [COLOR] option on the [SPECIAL] menu. 2. Use [LEFT] or [RIGHT] button to change a color effect. ON: Color screen OFF: B/W (Black and White) screen
Setting the SYNC (Synchronization)
The SYNC function is available only with AC power source. 1. Select [SYNC] option on the [SPECIAL] menu. 2. Use [LEFT] or [RIGHT] button to select [INT] or [LL] (Line Lock). INT: Selects for using the internal synchronization. - - Select [LL] mode and press [SET]. Select a desired phase using the [LEFT] or [RIGHT] button.
Note: When you use the DC 12V power, the [SYNC] option is fixed to [INT] mode only.
LL (Line Lock): Selects for the operation of multi cameras because it synchronizes the camera phase by using the external signal (AC power signal).
Setting the USER TITLE
You can use the camera identification to assign a number and character to the camera (0 - 9, A-Z, a-z). The USER TITLE is displayed on the upper left of the screen. To disappear the user title, select [OFF].
1. Select [USER TITLE] option on the [SPECIAL] screen. 2. Use [LEFT] or [RIGHT] button to select a [ON] then press [SET]. The USER TITLE menu appears. - / : Moves cursor to left or right.
Language Setting
Select a language for the Setup menu and on-screen display.
3. Use [UP], [DOWN], [LEFT] or [RIGHT] button to select a character or number. - - - - CLR: If you enter the wrong code, select CLR then press [SET]. POS: Use [UP], [DOWN], [LEFT] or [RIGHT] button to move position of USER TITLE on the screen. END: Confirm your selection. A (Blank): Inserts a space at the cursor position. 1. Select [LANGUAGE] option on the [SPECIAL] screen. 2. Press [LEFT] or [RIGHT] button to select a language.
Reset Settings
CAMERA REBOOT: To reboot the camera system. FACTORY RESET: To reset the camera setting to factory setting, select [FACTORY RESET] option.
1. Select [RESET] option. 2. Press [SET] button and the RESET menu appears. 3. Use [UP] or [DOWN] to select option.
Specifications
Model Total/Effective Pixels Pick-up Device Lens Iris Signal Process Scanning System Synchronization System Scanning Frequency Resolution S/N Ratio Low Luminance Video Output Signal Auto Gain Control 0.0002 Lux (Sens-up Auto) 0.2 Lux (AGC High, DNR) 50 Hz (VD) LV903P 470K/440K Pixels LV903N 410K/380K Pixels LV902P 470K/440K Pixels LV902N 410K/380K Pixels LV901P 470K/440K Pixels LV901N 410K/380K Pixels 1/3 Interline Color CCD Vari-Focal Lens (f = 2.8 ~ 11mm / F = 1.2) DC/ELC Selectable LG XDI-s 2:1 Interlace Internal/Line Lock 59.94 Hz(VD) 50 Hz (VD) 59.94 Hz(VD) 50 Hz (VD) 59.94 Hz(VD) 540 Lines More than 52 dB (AGC Off, F 1.2) 0.2 Lux (AGC High, DNR) OFF/LOW/MIDDLE/HIGH 0.0002 Lux (Sens-up Auto) 0.2 Lux (AGC High, DNR)
1.0 Vp-p Composite Signal (75 ohm)
Model Exposure Electric Shutter White Balance Back Light WDR MOTION DET. Power Consumption Operation Temperature Storage Temperature Weight Dimension ( x H) OFF/WDR/BLC/HSBLC 60dB 1/50 1/90,000 (Auto Mode) 1/60 1/90,000 (Auto Mode) LV903P LV903N LV902P 1/50 1/90,000 (Auto Mode) LV902N 1/60 1/90,000 (Auto Mode) LV901P 1/50 1/90,000 (Auto Mode) LV901N 1/60 1/90,000 (Auto Mode) ALC/ELC

Copyright 2010 by The American Society for Biochemistry and Molecular Biology, Inc.
The biological function(s) of carnosine and related dipeptides is still mysterious, although several theories have been proposed. Because of its abundance and its pKa close to the physiological pH, carnosine is thought to act as a buffer, neutralizing the lactic acid produced in a working muscle (4). It has also been proposed to be an antiglycation agent (for review see Ref. 6) and a blood glucose regulator (7), while the dipeptide present in the olfactory system might be either a neurotransmitter or a neuromodulator (for review see Ref. 8). Carnosine and anserine have been shown to be efficient chelators of copper ions in vitro (9) and all carnosine related dipeptides have been postulated to be potent endogenous antioxidants (10). However, none of these putative physiological functions has been definitively verified yet. Similarly, information on the enzyme that catalyzes the formation of carnosine and related dipeptides remains highly deficient. Carnosine is known to be synthesized from -alanine and Lhistidine by an ATP-dependent synthase (EC 6.3.2.11), which has been partially purified from different sources (11-14) and shown to catalyze also the synthesis of homocarnosine. The fate of ATP in the reaction has never been directly demonstrated, but based on indirect arguments, the nucleotide triphosphate is thought to be converted to AMP and inorganic pyrophosphate. Two proteins encoded by different genes were shown to degrade carnosine in humans and other mammals (15). The first one (CN2, formerly named human tissue carnosinase, EC 3.4.13.18) is a Mn+2-dependent cytosolic enzyme ubiquitously expressed in human tissues. This enzyme is now named cytosol nonspecific dipeptidase, since it does not degrade homocarnosine and exhibits a rather broad specificity towards various dipeptides. The second one (CN1, EC 3.4.13.20) is a genuine carnosinase (former human serum carnosinase), which breaks down both carnosine and homocarnosine and is found in serum and brain tissue. Interestingly, deficiency of this enzyme leads to hypercarnosinemia and hypercarnosinuria and was associated with neurological symptoms (16,17). Further progress on the role of carnosine and homocarnosine would highly benefit from the identification of the enzyme that synthesizes it and this was the purpose of the present work. We chose
to purify this enzyme from chicken muscle, a rich source of carnosine synthase, and succeeded to identify it by combining protein purification and mass spectrometry analysis with a database mining approach. EXPERIMENTAL PROCEDURES Materials-Reagents, of analytical grade whenever possible, were from Sigma (Bornem, Belgium), Acros (Geel, Belgium), Roche Applied Science (Mannheim, Germany) or Merck (Darmstadt, Germany). [3H]-alanine and [14C]aminobutyric acid were purchased from Moravek Biochemicals (Brea, USA). DEAE-Sepharose, QSepharose, Superdex-200 resins, 1 ml HisTrap HP (Ni2+ form) and PD-10 columns were obtained from GE Healthcare (Diegem, Belgium). ATPSepharose was a kind gift to DV from Serenex (USA). AG50W-X4 (100-200 mesh) resin came from Bio-Rad (Nazareth Eke, Belgium), and Vivaspin-15 centrifugal concentrators were from Sartorius (Stockport, United Kingdom). Enzymes and DNA modifying enzymes as well as the TurboFect transfection reagent were obtained from Fermentas (St-Leon-Rot, Germany). FirstChoice human brain RNA was from Applied Biosystems (Halle, Belgium). Assay of Carnosine Synthase ActivityCarnosine synthase activity was determined by measuring the incorporation of either [3H]alanine or [14C]-aminobutyric acid into the corresponding dipeptide. The standard incubation mixture (0.11 ml) contained 50 mM Hepes, pH 7.5, 10 mM KCl, 1 mM EGTA, 1 mM MgCl2, 1 mM DTT, 3 mM ATP-Mg, 3 mM L-histidine (or other acceptors), either 1 M [1H + 3H]-alanine (about cpm) or 23.4 M [12C + 14C] aminobutyric acid (about cpm). The reaction was started by the addition of the enzyme preparation and carried out at 37C for 20 min unless otherwise described. Dipeptide production was linear for at least 30 min under all conditions studied. The incubation was stopped by the addition of 0.1 ml of the reaction medium to 0.2 ml of ice-cold 10 % (w/v) HClO4. The samples were diluted with 0.12 ml of H2O and centrifuged at 13,000 g for 10 min. After neutralization of the supernatant with 3 M K2CO3, the salts were removed by centrifugation (13,000 g for 15 min) and the clear supernatant was diluted 5 times with
20 mM Hepes, pH 7.5 and 2 ml were applied to AG50W-X4 columns (1 ml, Na+ form), equilibrated with 20 mM Hepes, pH 7.5. The unreacted radiolabeled substrate was removed by washing the columns with 10 ml of the same buffer and carnosine or homocarnosine were eluted with ml of 20 mM Hepes pH 7.5 containing 0.5 M NaCl. To elute dipeptides that were more positively charged, the columns were washed with ml of 1 M NH3OH. In all cases, the samples to be counted were mixed with 5 volumes of scintillation fluid (Ultima Gold, Perkin-Elmer) and the incorporated radioactivity was analyzed with a Packard Tri-Carb 2300 TR liquid scintillation counter. Purification of Chicken Carnosine Synthase-Chicken pectoral muscle (250 g) was homogenized with 4 volumes (w/v) of buffer A (50 mM Hepes, pH 7.5, 10 mM KCl, 1 mM DTT, 1 mM EGTA, 1 mM MgCl2, 5 g/ml leupeptin and 5 g/ml antipain) with an Ultra Turrax homogenizer. The homogenate was centrifuged for 30 min at 15,000 g and the supernatant (550 ml) split into two equal halves. One half was immediately utilized and the other was frozen at -70C and subjected to the same procedure a few days later. The supernatant (250 ml) was diluted with buffer A to 375 ml and applied to a DEAE-Sepharose column (200 ml) equilibrated with the same buffer. The column was washed with 400 ml of buffer A, developed with a NaCl gradient (0-0.5 M in 1000 ml) in buffer A and fractions (7 ml) were collected. The most active fractions of the two columns were pooled (55 ml), diluted to 334 ml with buffer B (50 mM Tris HCl, pH 8.0, 10 mM KCl, 1 mM DTT, 1 mM EGTA, 1 mM MgCl2, 5 g/ml leupeptin and 5 g/ml antipain) and applied to a Q-Sepharose column (12 ml) equilibrated with buffer B. The column was washed with 36 ml of buffer B containing 35 mM NaCl, and the retained protein was eluted with a NaCl gradient (35-500 mM in 300 ml in buffer B). The most active fractions (23 ml) were pooled, concentrated to 2.3 ml in 2 Vivaspin-15 ultrafiltration devices and loaded on a Superdex-200 16/60 column (120 ml) equilibrated with buffer A containing 100 mM NaCl. The most active fraction (1.5 ml) was diluted 3-fold with buffer C (50 mM Hepes, pH 7.5, 50 mM NaCl, 10 mM KCl, 1 mM DTT, 1 mM EGTA, 10 mM MgCl2, 2 g/ml leupeptin and 2 g/ml antipain) and loaded onto an ATP-Sepharose column (0.2
ml) equilibrated with the same buffer. The column was first washed with 2 ml of buffer C and with 2 ml of the same buffer containing 100 mM NaCl. The retained proteins were eluted (6 fractions of 0.4 ml) with buffer C containing 5 mM ATP-Mg. Fifty l were kept for the MS/MS analysis, and the remaining 0.35 ml were supplemented with 0.7 mg BSA. All purification steps were performed at 4C and the enzymatic preparation was stored at -70C between steps. The complete purification procedure was performed twice with similar results. Protein concentration was determined spectrophotometrically according to Bradford (18) using bovine -globulin as a standard. Protein content in the polyacrylamide-SDS gel bands, which co-eluted with carnosine synthase activity in the last purification step (ATP-Sepharose), was quantitated by densitometric analysis using ImageJ software (NIH, USA). The total amount of protein in the ATP-Sepharose fractions, as determined densitometrically, was in perfect agreement with the data obtained with the Bradford assay. Determination of Adenine Nucleotides-To determine the changes in adenine nucleotide concentration taking place during carnosine synthesis, a sample (25 g protein) of Superdex 200-purified chicken carnosine synthase was incubated at 37C in the absence or presence of 1 mM -alanine and 3 mM L-histidine in a reaction mixture (0.33 ml) containing 50 mM Hepes, pH 7.5, 0.2 mg/ml BSA, 10 mM KCl, 1 mM EGTA, 1 mM MgCl2, 1 mM DTT, 1 mM ATP-Mg, 1 mM Na3VO4 (a nonspecific inhibitor of ATPases), and 100 M diadenosine pentaphosphate (AP5A, a potent inhibitor of adenylate kinase, (19)). Neither Na3VO4 nor AP5A affected the formation of carnosine at the concentrations used. To confirm the complete inhibition of adenylate kinase activity by AP5A, the enzyme was incubated in the same reaction mixture in which -alanine and Lhistidine had been replaced by 100 M AMP. After 0, 60 and 120 min at 37C, 0.1 ml of the reaction mixture was removed and mixed with 30 l of ice-cold 20 % (w/v) HClO4 to stop the reaction. Samples were centrifuged at 13,000 g for 5 min at 4C and the supernatants (0.12 ml) were immediately withdrawn and neutralized with 20 l of 3 M K2CO3. The salt precipitate was removed by centrifugation (13,000 g for 15 min) and the clear supernatants (0.1 ml) were analyzed in an Agilent 1100 HPLC. Separation of adenine
nucleotides was achieved by chromatography on Whatman Partisphere SAX column (4.mm, 5 m particle size) in a gradient of 0.01-0.5 M NH4H2PO4 (pH 3.7) at a flow rate of 2 ml/min (20). The detection of nucleotides was performed with a diode-array detector at = 254 nm. Quantification was achieved using external standards of ATP, ADP and AMP. Identification of Chicken Carnosine Synthase by Tandem Mass Spectrometry-The bands co-eluting with carnosine synthase activity in the ATP-Sepharose purification step were cut from a 10 % polyacrylamide-SDS gel and digested with trypsin. In-gel digestions and desalting of the peptides were performed as described in (21). Peptides were analyzed by LCtandem mass spectrometry in a LTQ XL ion-trap mass spectrometer (Thermo Scientific, USA) fitted with a microelectrospray probe. The results were analyzed using the X-calibur software (Thermo Scientific) and the proteins were identified using Proteome Discoverer (Thermo Scientific) with a False Discovery Rate 5 %, as delivered by a target-decoy database search. To identify chicken ATPGD1, the downloaded chicken database of the MS/MS software (IPI Chicken, ver. 3.47) was updated with an amino acid sequence of chicken ATPGD1 as determined in the present work. Determination of the Sequence of Chicken ATPGD1-Chicken total muscle RNA was prepared from 200 mg of pectoral muscle with the use of TriPure reagent according to the manufacturers instructions. Muscle cDNA was synthesized using M-MuLV reverse transcriptase (Fermentas, StLeon-Rot, Germany), with random hexamers and 2 g total RNA according to the manufacturers instructions. A 5 primer containing the putative ATG codon (GCAGCATGATATCGGTGGAC) and a 3 primer containing the putative stop codon (CCGCCGTGGTTATTTGAAGTG) were used to PCR-amplify the open reading frame encoding chicken ATPGD1. The sequences of 5 and 3 primers were chosen, based on chicken Expressed Sequence Tags (ESTs) BM487018.1 and BM490056.1 and chicken trace sequence TI: 26256606 from Whole-Genome Shotgun reads (trace-WGS) collection in NCBI Trace Archive. These sequences were identified by BLAST searches as being homologous to human ATPGD1. The reaction was performed in the presence of 1 M betaine with the use of Pfu DNA polymerase and
chicken total muscle cDNA as template. A PCR product of the expected size (about 2.7 kb) was obtained, purified and sequenced. Full length protein-coding chicken ATPGD1 sequences (cDNA) was deposited in GenBank database and accession number was obtained (GU453679). The sequence of oyster (Crassostrea virginica) ATPGD1 was reconstituted from ESTs CD648102.1, CD648025.1, CD647140.1, CD649213.1 and CV089447.1. Other ESTs provided at least two-fold additional coverage of the entire sequence and confirmed the deduced peptide sequence. Overexpression and Purification of Human and Mouse recombinant ATPGD1-Human brain and mouse muscle and brain cDNA were used to PCR-amplify the open reading frames encoding human and mouse ATPGD1 (GenBank Accession Number NM_001166222 and NM_134148, respectively) using Pfu DNA polymerase in the presence of 1 M betaine. Human brain ATPGD1, was amplified using a 5 primer containing the initiator codon (GTGGAATTCTATGCTCTCCCTGGATCCATC G) preceded by an EcoRI site and a 3 primer containing the stop codon (CAGGCGGCCGCCTATTTGAAGTGAGACAG GAAG) flanked by a NotI site. Similarly, a 5 primer containing the initiator codon (GTGGAATTCTATGCTCTGCCTGGATCCACT G) and a 3 primer containing the stop codon (CAGGCGGCCGCCTATTTGAAATGAGACAG GAAATG) were used for the amplification of mouse muscle and brain ATPGD1. The amplified DNA products of the expected size were digested with the appropriate restriction enzymes and cloned into the pEF6/HisB expression vector (Invitrogen, USA), which allows the production of proteins with an N-terminal His6 tag, and verified by sequencing. The sequences of mouse brain and muscle ATPGD1 were the same, and only the construct derived from muscle was used in further experiments. For transfections, HEK-293T cells were plated in 85-mm Petri dishes at a cell density of 2.cells per plate in Dulbecco's minimal essential medium supplemented with 100 units/ml penicillin, 100 g/ml streptomycin, and 10 % (v/v) fetal bovine serum, and grown in a humidified incubator under 95 % air and 5 % CO2 atmosphere at 37C. After 24 h, each plate was transfected with 6 g of the appropriate vector using the
TurboFect transfection reagent (Fermentas) according to the protocol provided by the manufacturer. After 48h the culture medium was removed, the cells were washed with 5 ml phosphate buffered saline and harvested in 0.5 ml of 50 mM Hepes, pH 7.5, containing 10 mM KCl, 1 mM MgCl2, 5 g/ml leupeptin and 5 g/ml antipain. The cells were lysed by freezing in liquid nitrogen and after thawing and vortexing, the extracts were incubated on ice with 125 U/ml DNase I (Sigma) for 30 min and were then centrifuged at 4 C (15,000 g for 30 min) to remove insoluble material. For the purification of mouse and human recombinant ATPGD1, the supernatant (17 ml) was diluted 2-fold with buffer A (50 mM Hepes, pH 7.5, 300 mM NaCl, 10 mM KCl, 1 mM MgCl2, 5 g/ml leupeptin and 5 g/ml antipain) and applied on a HisTrap HP column (1 ml) equilibrated with the same buffer. The column was washed with 30 ml buffer A and the retained protein was eluted with a stepwise gradient of imidazole (60-300 mM, 60 ml) in buffer A. Both human and mouse ATPGD1 were eluted with 150300 mM imidazole in homogeneous form as confirmed by SDS-PAGE (not shown). The enzyme preparations were desalted on PD-10 columns equilibrated with 50 mM Hepes, pH 7.5, 10 mM KCl, 1 mM DTT, 1 mM EGTA, 1 mM MgCl2. Protein concentration was determined spectrophotometrically according to Bradford (18) using bovine -globulin as a standard. 0.5 mg (mouse) or 1 mg (human) of pure recombinant enzyme were obtained from 40 mg or 70 mg of soluble HEK 293T cell protein, respectively. The purified enzymes were supplemented with 2 mg/ml BSA and stored at -70C. Product Analysis-To obtain sufficient amount of the dipeptide formed in the reaction catalyzed by recombinant mouse ATPGD1 for mass spectrometry analysis, the reaction mixture was scaled up 10-fold. Briefly, 14 g mouse ATPGD1 were incubated for 16 h at 37C in 1 ml of a reaction mixture containing 50 mM Hepes, pH 7.5, 200 g BSA derived from the enzyme preparation, 10 mM KCl, 1 mM EGTA, 1 mM MgCl2, 1 mM DTT, 3 mM -alanine, 3 mM Lhistidine in the absence or presence of 3 mM ATPMg. The reaction was stopped by the addition of 0.2 ml of 30 % (w/v) HClO4. After neutralization with 3 M K2CO3, the salts were removed by
centrifugation (13,000 g for 15 min) and the clear supernatant was diluted 5 times with 20 mM Hepes, pH 7.5. The sample (6 ml) was applied to AG50W-X4 column (1 ml, Na+ form), the unreacted substrates were removed by washing with 12 ml of the same buffer and the dipeptide was eluted with 2 ml of 1 M NH4OH. The purified dipeptide was evaporated to dryness, dissolved in 1 ml of 200 mM ammonium bicarbonate, and Nacetylated with 10 % acetic anhydride (Ac2O, v/v) for one hour at room temperature. Carnosine and N-acetylcarnosine were further purified by HPLC on a Hypercarb 2.mm column (ThermoHypersil) in a 5-50 % gradient of acetonitrile containing 0.05 % TFA at a flow rate of 0.2 ml/min. The column eluent was monitored with a UV detector at = 210 nm. All mass spectral analyses were performed on a LCQ Deca XP ion-trap spectrometer equipped with an electrospray source (Thermo Scientific). The sample dissolved in methanol was introduced directly into the source at a flow rate of 4 l/min. The LCQ operated in positive mode under manual control in the Tune Plus view with default parameters and active Automatic Gain Control. To confirm the structure of the precursor ions, lowenergy collision-induced dissociation (relative collision energy of 25%) was utilized. Calculations-Vmax and Km for the peptide synthase activity of studied enzymes were calculated with Prism 4.0 (GraphPad Software, USA) using a nonlinear regression. RESULTS Purification of Chicken Carnosine Synthase-During its purification, carnosine synthase activity was assayed by measuring the conversion of [3H]-alanine to [3H]carnosine in the presence of L-histidine and ATP. Carnosine synthase was purified from chicken breast muscle about 1500-fold by a procedure involving chromatography on DEAE-Sepharose, QSepharose, Superdex-200, and ATP-agarose. The ligase was eluted as a single peak in each of the purification steps (Fig. 1), indicating the presence of a single enzyme species. The gel filtration step on Superdex-200 disclosed that the size of native carnosine synthase was 415 kDa (not shown). The overall yield of the purification was only about 1.2 % (Table 1), but this low yield was due
to the fact that only the most active fractions from one step were used for the next one. For instance, only fraction 27 of the Superdex-200 column (i.e. only about 28 % of the recovered activity) was used for the final affinity chromatography. SDS-PAGE analysis indicated that carnosine synthase coeluted with two major polypeptides of about 100 and 90 kDa in the last purification step (cf. Fig. 1). Both bands were cut out from the gel, digested with trypsin, and the resulting peptides were analyzed by tandem mass spectrometry and compared to the chicken, mouse and human proteomes. Surprisingly, the analysis indicated that both bands contained heat-shock protein 90-alpha (Hsp90) as well as other proteins, but that none of these appeared to correspond to a putative ATP-dependent ligase. Similar negative results were obtained when the whole ATPSepharose-purified fraction was analyzed by tandem MS after trypsin digestion (not shown). Fate of ATP During Carnosine SynthesisThe availability of a substantially purified carnosine synthase preparation enabled us to identify the nucleotide produced from ATP by this enzyme. Figure 2 shows an experiment in which we followed carnosine synthesis catalyzed by the 1000-fold purified carnosine synthase preparation in the presence of 1 mM -alanine, 3 mM Lhistidine and 1 mM ATP. Carnosine formation was determined with the radiochemical assay, and ADP and AMP formation by HPLC. The incubation mixture was supplemented with 1 mM Na3VO4, a nonspecific inhibitor of many ATPases and phosphatases, and 100 M diadenosine pentaphosphate, to prevent any conversion of AMP to ADP by traces of adenylate kinase that still contaminated the preparation (19). The figure shows that the formation of carnosine was matched by a stoichiometric formation of ADP, if one took into account the slight ATPase activity observed in the absence of L-histidine and -alanine (possibly contributed by Hsp90). Remarkably, barely any formation of AMP could be detected (4 M in 60 min as compared to 150 M carnosine during the same time). To verify whether adenylate kinase was inactive under our assay condition, we replaced -alanine and L-histidine by 100 M AMP in the reaction mixture and checked the concentration of this nucleotide after increasing incubation times. Less than 3 % of AMP has been consumed after 1 hr (not shown). Taken together,
particularly Hsp90, which was present in similar amounts as ATPGD1. We believe that this contamination is coincidental, being due to the fact that chicken ATPGD1 has similar physicochemical properties as Hsp90, rather than to the two proteins forming a complex. Homogeneously purified human and mouse recombinant ATPGD1 were found to be active as carnosine synthases, indicating that the presence of Hsp90 in the reaction mixture is not required for activity. The finding that orthologues of ATPGD1 are present in other mammals, xenopus, and chicken, not in certain fishes, but present in an oyster agrees with the known distribution of carnosine and its methylated derivatives, anserine and balenine (4), and supports therefore the identification of ATPGD1 as carnosine synthase. This is also true for the tissue distribution of ATPGD1 (27). Carnosine synthase is an ADP-producing ligase-Our finding that purified chicken carnosine synthase produces stoichiometric amounts of carnosine and ADP indicates that the reaction mechanism that had been previously proposed (11,12) has to be revised. This stoichiometric formation of ADP and carnosine excluded the possibility that AMP would be formed and converted to ADP by contaminating adenylate kinase, because 2 molecules of ADP would then be expected to be produced per molecule of carnosine. Furthermore, the low adenylate kinase activity that was still present in the chicken enzyme was completely blocked by diadenosinepentaphosphate, which did not affect carnosine formation. The formation of ADP rather than AMP is also supported by the finding that carnosine synthase belongs to the ATP-grasp family. This family of enzymes mostly comprises ADP-forming ligases such as bacterial glutathione synthase, carbamoylphosphate synthase, D-alanine-Dalanine ligase, tyrosine-tubulin ligase and pyruvate carboxylase (22). To the best of our knowledge this superfamily does not comprise enzymes that hydrolyse ATP to AMP and PPi. As was proposed for other enzymes of the ATP-grasp family, it is likely that the reaction mechanism proceeds through the formation of an acyl phosphate, in this case -alanyl phosphate, but this point has not been investigated in the present study.
As emphasized by Bauer (28), previous studies made on the reaction mechanism of carnosine synthase have used very impure enzyme preparations and the conclusions that were derived have therefore to be taken with caution. Furthermore, our own study indicates that carnosine synthase is a very sluggish enzyme with a kcat lower than 1 s-1, meaning that the reaction mechanism can only be investigated with substantially purified preparations. None of the previous studies reports attempted at measuring the stoichiometry of the reaction in terms of ADP or AMP produced per molecule of carnosine formed, presumably because the enzymatic preparations used in these studies were contaminated with other activities able to produce ADP or AMP from ATP. The main argument that supported the conclusion that carnosine synthase is an AMPproducing ligase was the finding that the enzyme preparation produced carnosine from -alanyl adenylate and histidine (11). However, the conversion of -alanyl adenylate to carnosine was extremely inefficient, corresponding to less than 1 % of the total -alanyl adenylate consumption. We hypothesize that -alanyl adenylate was converted by a contaminating phosphodiesterase to -alanyl phosphate, a likely intermediate in the revised carnosine synthase reaction mechanism, and that carnosine was produced from the latter intermediate. Another argument that the same authors put forward to support an AMP-forming ligase activity was the finding that the enzyme preparation produced ATP from -alanyl adenylate and inorganic pyrophosphate (11). Again, this argument is mitigated by the finding that the formation of ATP was also observed with other aminoacyl-adenylates. The possibility that there would be two types of carnosine synthase, one producing ADP and the other AMP, is unlikely since we observed only one peak of carnosine synthase in all chromatographic steps. Furthermore, the specificity studies performed here indicate that our chicken enzyme preparation has similar properties to those described previously by other investigators. Taken together, all these considerations indicate that there is only one carnosine synthase and that this enzyme is an ADP-forming ligase. The Lack of Specificity of Carnosine Synthase-Previous studies disclosed that carnosine
synthase is relatively non-specific. This conclusion was based on studies with rather impure preparations purified from tissues. Therefore the lack of specificity observed previously could have been due to heterogeneity in the enzymatic preparations. However, both carnosine synthase purified from chicken muscle and the recombinant human and mouse proteins catalyze the synthesis of homocarnosine with catalytic efficiencies that are about 14-26-fold lower than those observed for carnosine synthesis, indicating that one single enzyme is responsible for both activities. Furthermore, our finding that the same sequence was amplified from mouse brain and skeletal muscle cDNA indicates that there is no specific brain isoform that would for instance be specialized in the synthesis of homocarnosine. This conclusion is consistent with previous reports showing the apparent identity of the enzymatic properties of the synthase partially purified from mouse neural tissue or muscle (14) and the high antigenic similarity of carnosine synthase from either rat or rabbit brain, skeletal muscle and heart (29). From a physiological standpoint, it should be mentioned that the lower catalytic efficiency of carnosine synthase with -aminobutyric acid as a substrate compared to -alanine is more than compensated by the higher concentration of aminobutyric acid compared to -alanine in brain (about 1.6 - 4.6 mM and 0.06 - 0.1 mM, respectively, for mouse brain (30)). As previously reported, carnosine synthase is also not very specific with respect to the aminocompound serving as the -alanine or aminobutyryl acceptor (11,14). Thus, the chicken enzyme is able to use N--methyl-L-histidine, Larginine and L-lysine in addition to L-histidine, whereas the mouse and human enzymes use fairly well L-ornithine and L-lysine (cf. Table 3). The alanyl-L-lysine or L-ornithine synthesizing activity can now be concluded to be due to an authentic lack of specificity of carnosine synthase rather than to the presence of different isoforms with different specificities. Considering that the concentration of L-lysine in human skeletal muscle is about 1.5-fold higher than that of L-histidine (0.53 mM and 0.37 mM, respectively, (31)) alanyl-L-lysine synthesis is expected to proceed in vivo at approximately 10 % of the rate of carnosine synthesis. The concentration of -alanyl-L-lysine is not known for human muscle, but it is 1000-fold
lower than that of carnosine in rabbit muscle (32). This low concentration of the wrong peptide is presumably due to the fact that it is degraded by a dipeptidase that is particularly active in muscle and specifically cleaves the -alanyl or -aminobutyryl derivatives of L-lysine, L-arginine or L-ornithine, but does not act on carnosine or homocarnosine and thus is different from carnosinase CN2 (33). The specific accumulation of carnosine in muscle tissue appears therefore to be due to the existence of two enzymes: one, carnosine synthase, that preferentially makes carnosine, but also synthesizes other dipeptides, and a second enzyme, not yet molecularly identified, that should destroy all the unneeded dipeptides. Other situations where one enzyme serves to compensate for the lack of specificity of another enzyme have been described. For example, L-2hydroxyglutarate dehydrogenase serves to degrade L-2-hydroxyglutarate, which is mistakenly made by the Krebs cycle enzyme L-malate dehydrogenase (34). Deficiency in the former enzyme causes L-2-hydroxyglutaric aciduria, a neurometabolic disorder. Another example is the ATP-dependent dehydratase that repairs the hydrated form of NADH made by glyceraldehyde3-phosphate dehydrogenase (35). It is likely that other enzymes catalyzing such metabolite repair reactions have still to be found. Evolution of carnosine synthase-An intriguing aspect in the structure of carnosine synthase is that its sequence has about twice the length expected for a member of the ATP-grasp family. Sequence comparisons indicate that it comprises two ATP-grasp domains, suggesting that the gene encoding carnosine synthase resulted from the fusion of two genes encoding two different ligases. The high conservation of the Cterminal domain indicates that this part of the protein comprises the catalytic site responsible for the ligation of -alanine to L-histidine and related amino acids. The N-terminal domain is much less conserved and has presumably no catalytic activity in vertebrates. Interestingly, the tripeptide alanyl-L-ornithyl-L-ornithine has been described in a bivalve (36). Since carnosine synthases are rather good at synthesizing -alanyl-L-ornithine, we speculate that this tripeptide is made by a bifunctional enzyme similar to carnosine synthase. Whether the N-terminal domain has now taken another function or is simply a remnant of
evolution in present day vertebrate carnosine synthase is unknown. Perspectives-The identification of carnosine synthase will allow progress in the understanding of the physiological function of carnosine and homocarnosine. The creation of knockout models or animals in which carnosine synthase is overexpressed could help define the role of carnosine as a buffer, a radical scavenger in muscle and in brain, or as a neurotransmitter in the olfactory system, and the function of homocarnosine as a -aminobutyrate reservoir. Knock-out models would tell us whether carnosine and/or homocarnosine deficiency lead to disease. No case of carnosine deficiency has yet been described in humans, but we surmise that this is because carnosine content of muscle and brain is only infrequently measured. We speculate that carnosine synthase deficiency could lead to symptoms like muscle cramp, myopathy, anosmia or hypoosmia, seizures and most probably other neurological problems. As the carnosine synthase gene is in the region of IDDM4 on chromosome 11q13, which is linked with insulin dependent diabetes (37), it is also possible that carnosine deficiency leads to glucose intolerance. It has indeed been shown that carnosine administration affects the function of pancreatic islets (7). The identification of the gene encoding carnosine/homocarnosine synthase will facilitate the diagnosis of carnosine or homocarnosine deficiency.
REFERENCES 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. Gulewitch, W., and Admiradzibi, S. (1900) Ber. Dtsch. Chem. Ges. 33, 1902-1905 Crush, K.G. (1970) Comp. Biochem. Physiol. 34, 3-30 Cameron, J.N. (1989) J. Exp. Biol. 143, 543-554 Boldyrev, A.A. (2007) Carnosine and oxidative stress in cells and tissues, Nova Scientific Publisher, NY Kish, S.J., Perry, T.L., and Hansen, S. (1979) J. Neurochem. 32, 1629-1636 Hipkiss, A.R. (2009) Exp. Gerontol. 44, 237-242 Sauerhfer, S., Yuan, G., Braun, G.S., Deinzer, M., Neumaier, M., Gretz, N., Floege, J., Kriz, W., van der Woude, F., and Moeller, M.J. (2007) Diabetes 56, 2425-2432 Bonfanti, L., Peretto, P., De Marchis, S., and Fasolo, A. (1999) Prog. Neurobiol. 59, 333-353 Brown, C.E., and Antholine, W.E. (1980) Biochem. Biophys. Res. Commun. 92, 470-477 Kohen, R., Yamamoto, Y., Cundy, K.C., Ames, B.N. (1988) Proc. Natl. Acad. Sci. U.S.A. 85, 3175-3179 Kalyankar, G.D., and Meister, A. (1959) J. Biol. Chem. 234, 3210-3218 Stenesh, J.J., and Winnick, T. (1960) Biochem. J. 77, 575-581 Skaper, S.D., Das, S., and Marshall, F.D. (1973) J. Neurochem. 21, 1429-1445 Horinishi, H., Grillo, M., and Margolis, F.L. (1978) J. Neurochem. 31, 909-919 Teufel, M., Saudek, V., Ledig, J.P., Bernhardt, A., Boularand, S., Carreau, A., Cairns, N.J., Carter, C., Cowley, D.J., Duverger, D., Ganzhorn, A.J., Guenet, C., Heintzelmann, B., Laucher, V., Sauvage, C., and Smirnova, T. (2003) J. Biol. Chem. 278, 6521-6531 Murphey, W.H., Lindmark, D.G., Patchen, L.I., Housler, M.E., Harrod, E.K., and Mosovich, L. (1973) Pediatr. Res. 7, 601-606. Willi, S.M., Zhang, Y., Hill, J.B., Phelan, M.C., Michaelis, R.C., and Holden, K.R. (1997) Pediatr. Res. 41, 210-213 Bradford, M.M. (1976) Anal. Biochem. 72, 248-254. Lienhard, G.E., and Secemski, I.I. (1973) J. Biol. Chem. 248, 1121-1123 Van Den Neste, E., Bontemps, F., Delacauw, A., Cardoen, S., Louviaux, I., Scheiff, J.M., Gillis, E., Leveugle, P., Deneys, V., Ferrant, A., and Van den Berghe, G. (1999) Leukemia 13, 918-925 Vertommen, D., Ruiz, N., Leverrier, P., Silhavy, T.J., and Collet, J.F. (2009) Proteomics 9, 24322443 Galperin, M.Y., and Koonin, E.V. (1997) Protein Sci. 6, 2639-2643 Nagase, T., Kikuno, R., Ishikawa, K., Hirosawa, M., Ohara, O. (2000) DNA Res. 7, 143-150 Altschul, S.F., Gish, W., Miller, W., Myers, E.W., and Lipman, D.J. (1990) J. Mol. Biol. 215, 403-410 Emanuelsson, O., Nielsen, H., Brunak, S., and von Heijne, G. (2000) J. Mol. Biol. 300, 10051016 Altschul, S.F., Madden, T.L., Schffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J. (1997) Nucleic Acids Res. 25, 3389-3402 Jackson, M.C., and Lenney, J.F. (1996) Inflamm. Res. 45, 132-135 Bauer, K. (2005) Neurochem. Res. 30, 1339-1345 Margolis, F.L., Grillo, M., Hempstead, J., and Morgan, J.I. (1987) J. Neurochem. 48, 593-600 Murakami, T., Yamane, H., Tomonaga, S., and Furuse, M. (2009) Eur. J. Pharmacol. 602, 73-77 Graham, T.E., Sgro, V., Friars, D., Gibala, M.J. (2000) Am. J. Physiol. Endocrinol. Metab. 278, E83-89 Matsuoka, M., Nakajima, T., and Sano, I. (1969) Biochim. Biophys. Acta 177, 169-171 Kumon, A., Matsuoka, Y., Kakimoto Y, Nakajima, T., and Sano, I. (1970) Biochim. Biophys. Acta 200, 466-474 Van Schaftingen, E., Rzem, R., and Veiga-da-Cunha, M. (2009) J. Inherit. Metab. Dis. 32, 135142 Acheson, S.A., Kirkman, H.N., and Wolfenden, R. (1988) Biochemistry 27, 7371-7375 Uchisawa, H., Naraoka, T., and Ono, T. (2007) Biochim. Biophys. Acta 1770, 790-796
16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36.
37. Nakagawa, Y., Kawaguchi, Y., Twells, R.C., Muxworthy, C., Hunter, K.M., Wilson, A., Merriman, M.E., Cox, R.D., Merriman, T., Cucca, F., McKinney, P.A., Shield, J.P., Tuomilehto, J., Tuomilehto-Wolf, E., Ionesco-Tirgoviste, C., Nistic, L., Buzzetti, R., Pozzilli, P., Joner, G., Thorsby, E., Undlien, D.E., Pociot, F., Nerup, J., Rnningen, K.S., Bain, S.C., Todd, J.A., and Bart's-Oxford Family Study Group. (1998) Am. J. Hum. Genet. 63, 547-556 FOOTNOTES This work was supported by grants from the Belgian Fonds National de la Recherche Scientifique (FNRS), by the Interuniversity Attraction Pole Programme Belgian Science Policy (Networks P6/05 and P6/28), by the DIANE centre of excellence program of the Rgion Wallonne. JD is supported by the postdoctoral fellowship from the FNRS. MVDC is chercheur qualifi of the FNRS. DV is collaborateur logistique of the FNRS. The abbreviations used are: ATPGD1, ATP-grasp domain containing protein 1; AP5A , P1,P5di(adenosine-5')pentaphosphate; BSA, bovine serum albumin; EST, expressed sequence tag; Hsp90, heat shock protein 90; TFA, trifluoroacetic acid. FIGURE LEGENDS
FIGURE 1. Purification of chicken carnosine synthase to near homogeneity. Chicken carnosine synthase was purified by chromatography on DEAE-Sepharose (A), Q-Sepharose (not shown), Superdex 200 (B), and ATP-Sepharose (C) as described in Experimental Procedures section. Fractions were tested for carnosine synthase activity and protein concentration was determined with the Bradford assay. The indicated fractions of the ATP-Sepharose column were analyzed by SDS-PAGE and the gel was stained with Coomassie Blue. AS, applied sample; FT, flow through; W, wash. Fractions 1-2 were eluted with 100 mM NaCl, while the others were eluted with 5 mM ATP-Mg. The indicated bands were cut out of the gel, submitted to trypsin digestion and analyzed by mass spectrometry. FIGURE 2. Time-course of the changes in carnosine, ADP and AMP concentration during carnosine synthesis A chicken enzyme preparation (11 g protein) purified by chromatography on DEAESepharose, Q-Sepharose and Superdex 200 was incubated for 0, 60 and 120 min with 1 mM ATP-Mg in the absence (empty symbols) or the presence (filled symbols) of 3 mM L-histidine, 1 mM -alanine, as well as cpm of [3H]-alanine. ADP values were calculated by subtracting ADP concentration values in the absence of -alanine and L-histidine from the corresponding values in the presence of these substrates. The formation of radiolabelled carnosine was determined after chromatographic separation from -alanine. ADP and AMP were determined by HPLC. The figure shows the mean of two experiments performed under similar conditions and yielding similar results (less than 5 % variation). FIGURE 3. Amino acid sequence alignment of human ATPGD1 with its oyster, mouse and chicken orthologues. Fully conserved residues are highlighted with a black background. The human (GenBank Accession Number NP_001159694) and mouse sequences (GenBank Accession Number NP_598909) have been confirmed by PCR amplification of the cDNA and sequencing. The chicken sequence has been determined in the present work (GenBank Accession Number GU453679). The oyster (Crassostrea virginica) sequence was reconstituted from ESTs. The peptides identified by mass spectrometry in the protein purified from chicken pectoral muscle are underlined in the chicken sequence. FIGURE 4. Mass spectra of a dipeptide produced by mouse ATPGD1. Homogenous recombinant mouse ATPGD1 was incubated for 18 h with 3 mM -alanine and 3 mM L-histidine in the absence or presence of 3 mM ATP-Mg. The produced dipeptide was purified and submitted to mass spectrometry either as such or after acetylation with acetic anhydride. Tandem mass spectra of the putative carnosine (A) and N-acetylated carnosine (B) were acquired. The identity of the carnosine fragment ion at m/z 180 was [M+H-H2O-HCO]+.
Table 1. Purification of carnosine synthase from chicken pectoral muscle Fraction Volume
Total protein
Total activity
pmol min-1
Specific activity
pmol min-1 mg-1
Purification
x g supernatant DEAE Sepharose Q Sepharose Superdex 200 ATP Sepharose
750 55.3
17240 64.7 16.7 2.27 0.139
0.74 68.731 1119
100 35.1 29.7 13.0 1.2
The data represent values only for the most purified fraction.
Table 2. Proteins identified in gel bands submitted to trypsin digestion and tandem MS analysis For each band, identified proteins were listed according to the number of spectral counts observed in MS/MS analysis. For each protein, the sequence coverage is also indicated. Occasional peptide hits corresponding to keratins have not been included in the table. Gel band
Protein name
International Protein Index
not available IPI00596586 IPI00596221 IPI00593819
Spectral counts
Coverage
Chicken ATPGD1* Heat shock protein HSP 90-alpha similar to G protein-coupled receptor 112 Putative uncharacterized protein similar to transcription elongation factor B (SIII), polypeptide 1
53.48 42.58 6.00 33.04
Heat shock protein HSP 90-alpha
GM3 synthase hypothetical protein; kelch domain containing 7A 163 kDa protein similar to otogelin 26S proteasome non-ATPase regulatory subunit 1 similar to novel Tctex-1 family domaincontaining protein similar to N-acetylglucosaminyltransferase V
IPI00596586
IPI00577387 IPI00580729 IPI00819350 IPI00598268 IPI00590920
4.35 2.74 0.81 2.20 17.86
IPI00583347
*ATPGD1 was not found with the available chicken proteome database, but only after the latter had been updated with the chicken ATPGD1 sequence (see main text).
Table 3. [3H] -alanine incorporation into various dipeptides catalyzed by carnosine synthase -alanine incorporation was determined with the use of homogenous recombinant mouse or human enzyme and chicken muscle enzyme purified by chromatography on DEAE-Sepharose, Q-Sepharose and Superdex 200. Enzyme preparations were incubated for 20 min in the presence of 3 mM ATP, 1 M [1H+3H] -alanine and 3 mM of the indicated -alanine acceptor. Values are the means SEM of 3-4 separate experiments. -alanine acceptor Carnosine synthase
Chicken
L-histidine N--methylhistidine* N--methylhistidine* histamine L-lysine L-ornithine L-2,4-diaminobutyric acid L-arginine agmatine cadaverine putrescine
2.6 1.16 4.4 0.9 6.1 2.0 3.1 1.5
0.9 0.3 1.3 0.3 2.2 0.9 0.7 0.3
4.6 1.18 1.6 0.7 4.0 1.0 3.3 1.3
*N--methylhistidine and N--methylhistidine are also known as 1-methyl-L-histidine and 3-methyl-Lhistidine, respectively.
Table 4. Kinetic properties of mouse, human and chicken carnosine synthase. Kinetic properties were determined with the use of homogenous recombinant mouse or human ATPGD1 and chicken muscle carnosine synthase purified by chromatography on DEAE-Sepharose, Q-Sepharose, Superdex 200 and ATP-Sepharose. #Determinations for indicated substrates were performed with enzyme preparations that were incubated for 20 min in the presence of 3 mM ATP, variable concentrations of either [1H+3H] -alanine or [12C+14C] aminobutyrate and 3 mM L-histidine, while the measurements for the other substrates (indicated by asterisk) were done in the presence of non-saturating concentration (1 M) of [1H+3H] -alanine. Values are the means of two or three separate experiments. In the latter case, the SEM value is given. Substrate Mouse ATPGD1 Vmax nmol min-1 mg-1
0.67 0.02 0.60 0.02 0.78 1.92 0.66
0.46 0.04 6.44 0.33 0.57 0.05 0.11 0.01 1.59 0.52 4.51
kcat/Km s-1 mM-1
1.16 0.07 0.002 0.0100 0.0009 0.0066 0.0003
Human ATPGD1 Vmax nmol min-1 mg-1
65.3 2.1 54.7 1.2 0.76 0.01 0.76 0.03 0.61 0.28 0.62
1.28 0.05 0.003 0.004 0.0002 0.0001 0.0001
Chicken carnosine synthase Vmax Km nmol min-1 mg-1 mM
84.1 1.6 3.63 0.08 3.30 0.09 3.43 2.54 3.51 0.033 0.005 0.35 0.02 0.19 0.01 0.10 0.01 1.42 1.62 0.39
6.03 0.44 0.032 0.055 0.0040 0.0026 0.0150
-alanine# -aminobutyrate# ATP-Mg* L-histidine* L-lysine* L-ornithine* N--methylhistidine*
0.09 0.01 1.84 0.11 0.42 0.03 0.37 0.05 4.67 7.66 24.7
Figure 1. (Drozak et al)
Carnosine synthase activity (pmol/min/ml) or [NaCl] x 10 (mM)
Carnosine synthase
0.133 0.20
Fraction
Carnosine synthase activity (pmol/min/ml)
A280 (U)
Protein
Protein concentration (mg/ml)
0.5 0.4 0.3 0.2 0.1 0.0
kDa 116 66
8 Band 1 Band 2
Figure 2. (Drozak et al)
(+ -Ala + L-His)
Reaction product [M]
(- -Ala - L-His)
AMP ADP Carnosine
60 120
Incubation time [min]
Figure 3. (Drozak et al)
Oyster Human Mouse Chicken Oyster Human Mouse Chicken Oyster Human Mouse Chicken Oyster Human Mouse Chicken Oyster Human Mouse Chicken Oyster Human Mouse Chicken Oyster Human Mouse Chicken Oyster Human Mouse Chicken Oyster Human Mouse Chicken Oyster Human Mouse Chicken Oyster Human Mouse Chicken Oyster Human Mouse Chicken Oyster Human Mouse Chicken Oyster Human Mouse Chicken
Tags
Minox GT-E Tt ABS FZ6-S-2005 ADV-700 CI-5100C 42RD1E WV-CL350 PFM42V1 CL-P0024 Nuvi 1350 Digital Motorola H560 Simulator F44010VI SA3085 02 CX1800 Travelmate 2440 RX-450 TH-42PX60EH Kxtg6582 CP770 DC E820 42LF75 Cooker T8611M PSR-A3 LQ-500 MP 160 HM100JC VX5200 HP-237 22B-7 TS-WX20LP Dongle Wifi FWD798 DCD-510AE EH-TW3800 SA-AK78 Classic MS8308E L1715S ZSR0104UP MVX460 AJ3600 8410D LH-T760SB BHB613 BG 19 KV-29DS65 DSC-W330 R N14644 ZAP 4 MP3322 LS-Q096AAL XR2000 SDV4230 Dmclz3 GR-555 2X 9200 ECM-HW1 LC 850 CDR785 21FU1RK Kb-217F Draft 7 4080xcdt Escort-2000 Review Watch E87 KV-28FQ70E YSP-3000 M-7050 Quest 2 CP1370EST APX5NA GT1033 KX-FLM672CX Maxiview Autostar 494 Fostex D-15 H5360 F2380MX KE-P42m1 CDX-S2010X DCR-HC42 Nokia 3315 ESL4115 81187 ITD 62 Singer 97-4 3000N DPL906 AT-35 F1403TDS Recorder SD-P2800 DD-50 5 SET 3024X 24040 RT-21FA31X
manuel d'instructions, Guide de l'utilisateur | Manual de instrucciones, Instrucciones de uso | Bedienungsanleitung, Bedienungsanleitung | Manual de Instruções, guia do usuário | инструкция | návod na použitie, Užívateľská príručka, návod k použití | bruksanvisningen | instrukcja, podręcznik użytkownika | kullanım kılavuzu, Kullanım | kézikönyv, használati útmutató | manuale di istruzioni, istruzioni d'uso | handleiding, gebruikershandleiding
Sitemap
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101







