Indian J. Genet., 71(2) Special Issue : 1-9 (2011)
Marker assisted selection: a paradigm shift in Basmati breeding
A. K. Singh, S. Gopalakrishnan, V. P. Singh, K. V. Prabhu, T. Mohapatra , N. K. Singh , T. R. Sharma , M. Nagarajan , 5 K. K. Vinod , Devinder Singh, U. D. Singh , Subhash Chander , S. S. Atwal , Rakesh Seth , Vikas K. Singh, Ranjith K. Ellur, Atul Singh, Deepti Anand, Apurva Khanna, Sheel Yadav, Nitika Goel, Ashutosh Singh, Asif B. Shikari, Anita Singh and Balram Marathi Division of Genetics, 1NRCPB, 3Division of Plant Pathology, 4Division of Entomology, Indian Agricultural Research Institute, New Delhi 2 IARI-RBGRC, Aduthurai, Tamil Nadu 612 101; 5IARI-Regional Station, Karnal, Haryana 132 001
Abstract Marker assisted backcross breeding (MABB) provides a great opportunity for precise transfer of desirable donor segment by minimizing the linkage drag into a recurrent parent. In our lab, MABB was used for incorporating bacterial blight (BB) resistance genes (xa13 and Xa21) into the genetic background of Pusa Basmati1, which led to development of Improved Pusa Basmati 1 (Pusa 1460) as one of the first products of molecular breeding. Further, the parental lines of superfine grain aromatic rice hybrid Pusa RH 10 namely, Pusa 6A, Pusa 6B and PRR78 were improved for resistance to BB and blast by transferring genes xa13+Xa21 and Pi54 +Piz5, respectively. Presently, the pyramiding of genes for resistance to BB (xa13 and Xa21), blast (Piz5 and Pi54) and brown plant hopper (BPH; Bph 3, Bph 17, Bph 18, Bph20 and Bph 21) into Basmati rice varieties viz., Pusa Basmati 1121 and Pusa Basmati 6 is under way. In addition, a major QTL for salt tolerance (Saltol) is being transferred to Pusa Basmati 1121, which is widely grown in Haryana, the state having problem of salinity owing to underground brackish water. In order to develop genetically enhanced donor sources for resistance to biotic (BB, blast and BPH) and abiotic (salt tolerance, and phosphorus uptake) stresses in Basmati background, isogenic lines are being developed for major resistance genes/QTLs for respective stresses in the background of Pusa Basmati 1. Molecular mapping of fertility restorer gene(s) in Basmati restorer line PRR78 led to identification of two Rf gene linked molecular markers, RM258 and RM6100. Of these, RM6100 on validation in a set of rice germplasm showed 97.4% efficacy in identifying restorer lines from germplasm.QTL mapping using RIL population has unveiled several novel QTLs for grain and cooking quality traits. Molecular markers are also being routinely used for establishing variety/hybrids identity and authentication of genetic purity of hybrid seed lots.
Introduction Basmati rice from the Indian subcontinent is highly priced in the international market for its unique quality. The traditional Basmati cultivars are tall, prone to lodging, photoperiod and temperature sensitive and low yielding. Genetic improvement of Basmati rice at Indian Agricultural Research Institute (IARI) has led to the development of number of high yielding Basmati/aromatic rice varieties and hybrids (Pusa Basmati 1, Pusa Basmati 1121, Improved Pusa Basmati 1, Pusa Basmati 6, Pusa Sugandh 2, Pusa Sugandh 3, Pusa Sugandh 5 and hybrid Pusa RH10), wherein the duration of traditional Basmati rice varieties has been reduced from 160 days to 115-140 days with enhancement of productivity from 2.5 tons/ha to 6-8 tons/ha (Fig. 1.) [1]. As a result, Indias forex earning from export of Basmati rice has gone up from Rs. 294 crores in 1990-91 to Rs. 12,000 crores in 2009-10 (www.apeda.gov.in) (Table 1) to which the contribution of IARI varieties is more than 60 per cent. Albeit superiority in the quality and consumer acceptance, these varieties, parental lines of the hybrid and hybrid in general are susceptible to several biotic stresses such as bacterial blight (BB) caused by Xanthomonas oryzae pv. oryzae, blast caused by Magnoporthae oryzae and Brown Plant Hopper (BPH) infection by Nilaparvata lugens reducing yield and quality of rice. The most effective and environmental friendly management strategy of combating these stresses is exploitation of host plant resistance. Till date 34 bacterial BB genes [2], 85 blast resistance genes [3] and 21 BPH resistance genes [4] have been identified, mapped to specific chromosomal location and tightly linked

Key words :

Basmati Rice Breeding, MAS, QTL, Molecular markers.
*Corresponding authors e-mail: aks_gene@yahoo.com Published by Indian Society of Genetics & Plant Breeding, F2, First Floor, NASC Complex, PB#11312, IARI, New Delhi Online management by indianjournals.com

A. K. Singh et al.

[Vol. 71, No. 2

170 160

Duration (days)
Taraori Basmati Pusa Pusa Pusa RH 10 Basmati 1 Sugandh 2 (Hybrid)

Yield (t/ha)

genes, donors used, recurrent parents being improved, are given in Table 2. The progress in MABB for improvement of Basmati rice varieties is briefly presented trait wise.
Improvement of Pusa Basmati1for BB resistance
Pusa Basmati 1 (PB1) was the first semi-dwarf, high yielding Basmati quality rice variety released for commercial cultivation in 1989. Over period of time, this variety became highly susceptible to BB disease caused by Xanthomonas oryzae pv. oryzae. MABB approach was used to incorporate BB resistance in PB1 using IRBB55 (an isogenic line of IR24) as a donor for BB resistance genes xa13 and Xa21. The CAPS marker RG136 linked to xa13, and STS marker pTA248 linked to Xa21were used for the foreground selection. MAS for foreground genes xa13 and Xa21 was coupled with phenotypic selection for agronomic, grain and cooking quality traits in BC1F1, BC1F2 and BC1F3 generations. Background analysis with 252 polymorphic AFLP markers quantified the RPG recovery ranging from 80.4% to 86.7% in different BC 1F3 progenies [17]. Marker assisted background analysis was effectively integrated with foreground selection to identify superior BB resistant recombinants with minimal linkage drag [18]. One of these selections was released as Improved Pusa Basmati 1 (Pusa 1460), for commercial cultivation in 2007 as one of the first products of molecular breeding in the country.
Fig. 1. Breaking the jinx of unholy relationship between yields and duration
molecular markers have been developed. However, all these genes are available in non-Basmati sources and their transfer to Basmati background impairs the grain and cooking quality traits of Basmati rice varieties. Under such situations, marker assisted backcross breeding (MABB) offers a great opportunity for transferring desirable genes from unadapted donors to otherwise agronomically superior cultivars having specific weakness. With the availability of molecular markers and saturated molecular genetic map of rice, MAS has now become feasible both for traits controlled by major genes as well as QTLs. Given the information available, molecular markers can be successfully deployed for foreground as well as background selection in order to confirm the presence of resistance gene(s) and speedy recovery of recurrent parent genome (RPG) and phenome. With a view to develop BB, Blast, BPH and salt resistance/tolerance cultivars in our Basmati breeding program, number of resistance genes/QTLs are being incorporated into the Basmati varieties using the MABB strategy. A list of genes, markers their chromosomal locations, distance between marker and

Table 1. Trends in Basmati export since past two decades Quantity (m.t.) 0.23 0.37 0.84 1.16 1.04 1.18 1.50 2.00 Value (Rs. Crores) 1,930 2,727 2,511 3,900 7,200 12,000
Improvement of Parental lines of Pusa RH10 for BB resistance
PusaRH10 (PRH10), the first super fine grain aromatic rice hybrid developed by IARI, has the inherent advantage of earliness, high yield and better quality, but it is susceptible to BB. In order to incorporate BB resistance in PRH10, its maintainer line Pusa6B and restorer line PRR78 were first improved using Pusa 1460, as donor for xa13 and Xa21 through MABB approach. Later, the improved Pusa 6B was used as donor for xa13 and Xa21for improving Pusa 6A. The markers RG136 and pTA248 linked to BB resistance genes xa13 and Xa21, respectively, were used for foreground selection. Seventy-four STMS markers polymorphic between Pusa6B and Pusa1460, and 54 STMS markers polymorphic between PRR78 and Pusa1460, were utilized for background selection to recover the RPG ranging from 85.14 to 97.30% and 87.04 to 92.81% in the 10 best BC2F5 families of Pusa6B and PRR78, respectively [19, 20]. Stringent phenotypic selection coupled with the cooking quality analysis in the back cross generations aided in hastening the
Year 1990-91 1995-96 2000-01 2005-06 2006-07 2007-08 2008-09 2009-10
Source: APEDA, Ministry of Commerce, Govt, of India

Table 2.

LG 6 AP4007 AP5930 RM206 CCCATGCGTTTAACTATTCT CGTTCCATCGATCCGTATGG CGACGAACAACAACTCAAC CATGAAAGAAAGGAGTGCAG GTTCTCTCGGTTTGGACTTC ACAGAATTGACCAGCCAAG < 0.1 cM 0.10cM 0.6 cM Marker Forward primer Sequence GGCCATGGCTCAGTGTTTAT AGACGCGGAAGGGTGGTTCCCGGA GAGCTCCAGCTCTCCAAATG Gene Based AGACGCGGTAATCGAAGATGAAA Gene Based Reverse Primer Sequence Linkage distance Ref A [5] [6]
Genes/QTLs and their linked markers used for improvement of Basmati rice varieties

May, 2011]

Stress

Gene/ QTL

Donor Parent(s)

xa13 Xa21

Pusa 1460

xa13 prom pTA248

C101A51, Pusa 1602 and IRBLZ5-a 11

Pi- 54

Tetep, Pusa 1603 and DHMAS70Q164-2a RM247 RM224 S04G03 AP5930 RM208 RM589 RM5953 RM6217 B120 B121 RM3412 TTGAAAACTACGGGGTGAGG AACCAAAGTTGGTAACGAGAGC AAAGCAGGTTTTCCTCCTCC GCAGCAAGAGCAAGAAATCC AAACTTTCTGTGATGGTATC ATCATGGTCGGTGGCTTAAC TCTGCAAGCCTTGTCTGATG CATGAAAGAAAGGAGTGCAG CTTAACAATCAATGTTTAATGAAA ATCGATCGATCTTCACGAGG TAGTGCCGATCGATGTAACG CATATGGTTTTGACAAAGCG TGCTATAAAAGGCATTCGGG

DHMAS-70Q164-2a 12

<5 cM 0 cM 0.8 cM 0.05cM 1.2 cM 0.9 cM 3.2 cM
[8] [9] [10] B [11] [12] [13]

IRBLB5-M

GTTATATTATACTAATTGTTTATC ACAGAATTGACCAGCCAAG TAAGTCGATCATTGTGTGGACC CAGGTTCCAACCAGACACTG ATCCTTGTCTAGAATTGACA GTTCCTGCCGTACCAGCAG TACCCGCAGGATGAGATAC CGCAATCTATTAGACACCGTTC CCCATGTGCAATGTGTCTTC

IRBL9-W

IRBLb-B

RathuHeenathi

Bph-17

Bph-18

IR65482
Gene based Gene Based Gene based QTL based

[14] B [15] [16]

Bph-20

IR71033

Bph-21

Salt Tol.

Saltol
Marker assisted selection: A paradigm shift in Basmati breeding
A: Personal Communication with R M Sundaram, Senior Scientist, DRR, Hyderabad, B: Personal communication with R. Rathore, Associate Professor, HPKVV, Palam Pur
recovery of the recurrent parent genotype and phenotype.
Improvement of Pusa Basmati 1121 and Pusa Basmati 6 for BB resistance
The extent of donor segments in the improved version of Pusa6B was estimated to be <0.97 and <2.15 Mb in the genomic regions flanking xa13 and Xa21 , respectively, whereas in improved PRR78, it was estimated to be<2.07 and <3.45 Mb in the corresponding genomic regions. For a Basmati quality hybrid, grain and cooking quality traits are extremely important and thus emphasis was laid on analyzing such traits before advancing generations. Since, the background analysis using a sufficiently large number of markers and plants is expensive, phenotypic selection was combined with markerassisted background selection for making the marker assisted breeding protocol economic and effective [18]. Improved lines of Pusa6B and PRR78 showed yield advantages of up to 8.24 and 5.23%, respectively. The performance of the BB resistant version of PRH10 produced by intercrossing the improved parental lines was on par with or superior to PRH10. Improvement of PRH10 for BB resistance was facilitated by the availability of BB resistance genes xa13 and Xa21 in the Basmati background i.e., Improved Pusa Basmati 1.
At present Pusa Basmati 1121 is the most widely grown Basmati rice variety. During Kharif 2010, this variety was planted on 1.2 m.ha. area out of the total Basmati cultivating area of 2 m ha. Pusa Basmati 6 (Pusa
1401), a recently developed variety surpasses Pusa Basmati 1121in several attributes such as non-lodging and non-shattering habit, response to input use, dwarf stature, higher yield, non-chalky grains, strong aroma and better cooking quality. However, both these varieties are also susceptible to BB disease. In order to incorporate BB resistance in both these varieties, Pusa 1460 was again used as the donor parent for marker assisted transfer of BB resistance genes xa13 and Xa21 in Pusa Basmati 1121 and Pusa Basmati6. Superior plants with desirable grain and cooking quality have been recovered in BC2F1 and the rapid recovery of Basmati quality traits is attributed to the utilization of Basmati quality donor parent, Improved Pusa Basmati 1.

Development of near isogenic lines carrying major blast resistance genes in the background of Pusa Basmati 1
Until now, 83 major blast resistance genes have been documented in rice. However, all these genes are present in non-Basmati background and their transfer to Basmati varieties poses the problem of impairment of grain and cooking quality traits. Therefore, for the first time an attempt has been made to develop near isogenic lines for seven major blast resistance genes in the genetic background of PB1. The development of near isogenic lines was carried out using the series of IRBL lines (IRBL5-M: Pi5; IRBLb-B: Pib;IRBL9-W: Pi9 and IRBLz5-CA: Piz-5) and a doubled haploid line carrying three blast resistant genes (Pi1, Pi54, Pita) as the donors, and PB1 as the recurrent parent in independent backcross breeding programs. The BC4F1 generation for the genes Pi1, Pi54 and Pita, BC2F1s for the genes Piz-5 and Pib and BC3F1s for the genes Pi5 and Pi9 have been developed. Marker assisted foreground selection using gene linked molecular markers was performed in each generation to identify plants positive for the respective genes. Background selection with polymorphic markers between parents coupled with stringent phenotypic selection for morphological, grain and cooling quality traits was carried out for rapid RPG recovery. The RPG recovery in the selections for each cross combination namely, Pusa1633-6 (PB-1+Pita), Pusa1636-1 (PB-1+Pi5) and Pusa1637-1 (PB-1+Pi9) was found to be in the range of 86.2-92.7%, 71.5-88.7% and 89.06-93.7 respectively. The isogenic lines carrying different blast resistance genes developed are likely to be released as direct varieties after extensive testing and evaluation. Further, these lines will also serve as excellent donors for blast resistance genes in Basmati breeding program, and as genetic material for functional genomics to understand molecular mechanism of blast resistance.
Development of Blast resistant isogenic lines of PRR78
PRR78 is a Basmati quality restorer line and male parent of PRH10, is susceptible to blast disease. Simultaneous but step wise gene transfer strategy of MABB was deployed to transfer two blast resistance genes, Pi54 and Piz-5, from the rice cultivars Tetep and C101A51, respectively into PRR78. The BC2F1 populations were generated from individual backcross breeding program using marker assisted foreground selection with gene linked markers RM206 (linked to Pi54) and AP5930 (linked to Piz-5 )coupled with evaluation for morphological traits and blast resistance. BC2F1plants were advanced to BC2F6 by pedigree selection along with selection for grain and cooking quality traits in each of the generations. Based on background analysis, four lines viz., Pusa1603-06-10-2-12 and Pusa1603-06-583-91 with Pi54 gene; and Pusa1602-06-30-1-51 and Pusa1602-06-24-5-45 with Piz-5 gene showed RPG recovery of 89.01%, 88.25%, 87.88% and 86.66%, respectively. To pyramid both the blast resistant genes ( Pi54 and Piz-5 ), the best BC 2F 1s from individual backcross were intercrossed and subjected to foreground selection in the segregating generation to identify the plants homozygous for both the genes. The superior lines were carried forward through pedigree selection to develop Advanced Backcross Inbred Lines. Background analysis with 72 polymorphic STMS markers providing genome wide coverage revealed that Pusa1609-09-3-60, Pusa1609-09-3-4 and Pusa160909-11-30 carrying Piz-5 and Pi54 had RPG of 91.62%, 90.21%, and 88.80%, respectively. The hybrids produced with Pusa6A x improved ABILs were found to be on par with original PRH10 in yield, grain and cooking qualities with the advantage of blast resistance.

Improvement of Pusa Basmati 1121 and Pusa Basmati 6 for Blast resistance
The Blast resistant donors developed by marker assisted breeding namely Pusa 1602 (PRR78 + Piz-5) and Pusa 1603 (PRR78 + Pi54) were used to transfer the respective genes into Pusa Basmati1121 and Pusa Basmati6. The strategy involving foreground selection with gene linked molecular markers followed by stringent selection for morphological, grain and cooking quality traits coupled with background selection for accelerated recovery of RPG was adopted. In the BC3F1 generation, the lines of Pusa Basmati 1121 with Pi54 and Piz-5 are
being intercrossed to pyramid both blast resistance genes. Similarly the lines of Pusa Basmati6 with Pi54 and Piz-5 separately have also been intercrossed to pyramid both blast resistance genes.
Improvement of Pusa Basmati 1121 and Pusa Basmati 6 for BPH resistance
The donors for BPH resistance Rathu Heenathi (Bph3, Bph-17), IR68542 (Bph-18) and IR71033 (Bph20, Bph21) were screened for their resistance level in the green house using the standard protocol [21]. The genotype, Rathu Heenathi was found to be highly resistant followed by IR68542 and IR71033.These donors have been crossed with Pusa Basmati 1121 and Pusa Basmati 6, and the F1s were backcrossed with respective recurrent parents. Our ultimate goal is to pyramid genes for all these biotic stresses (BB, Blast and BPH) together in Pusa Basmati 1121 and Pusa Basmati 6.
Vandana as positive, N22 as partial, IR64 and Anjali as negative checks. All Basmati/aromatic rice varieties were Pup1 positive while most of the non-aromatic varieties were devoid of Pup1 locus. A sub-set of genotypes from each of the groups were evaluated under hydroponic conditions, under restricted P nutrition. A marked difference in root length and plant height was observed between the groups in hydroponic screening. The presence of Pup1 locus in all the Basmati varieties is reported for the first time. Further, validation of P use efficiency of Basmati varieties vis--vis presence of Pup1 locus is being undertaken in P sick plot and the findings has great relevance in management and use of phosphorous in Basmati rice.

Molecular mapping and MAS for fertility restorer gene(s) in Basmati Rice
The inheritance and molecular mapping of a fertility restorer gene in Basmati quality restorer line PRR78 was carried out using an F2 mapping population from the cross IR58025A X PRR78 employing microsatellite markers. Dominant monogenic control of fertility restoration was observed in the F2, and further confirmed by test cross data. Bulked segregant analysis (BSA) revealed the marker RM258 located on chromosome 10, linked to the restorer gene at a distance of 9.5 cM [24]. In order to discover a more tightly linked marker for Rf gene, mapping was carried out in the F2 population derived from the crossIR62829A/MTU9992 through BSA. The microsatellite molecular marker RM6100located on chromosome 10 was identified to be closely linked to Rf gene at a distance of 7cM. Further to assess the potentiality of the marker for utilization in the restorer breeding program for identification of restorers, RM6100 was validated with a set of 175 germplasm lines and found to highly effective in identifying most of the restorer lines with an efficacy of 97.4% [25]. Thus, RM6100 has become the integral part of hybrid breeding program for identification and breeding new restorer lines.
Improvement of Pusa Basmati 1121 and Pusa Basmati 6 for salt tolerance
The salt tolerant genotype FL478 [22], a recombinant inbred line from the cross IR29 x Pokkali was used as a donor to transfer the QTL Saltol governing salt tolerance at seedling stage into the recurrent parents Pusa Basmati 1121 and Pusa Basmati 6 through MABB in two independent backcross programs. A total of three markers linked to Saltol locus namely RM8094, RM3412 and RM493 were found to be polymorphic between the recurrent and donor parents. Foreground selection with the QTL linked molecular marker in each back cross generation to identify the gene positive plants, followed by stringent phenotypic selection for rapid recovery of RPG and phenome with salt tolerance is being adopted.
Genetic survey of Pup1 gene among aromatic and non-aromatic rice varieties using gene based markers
Development of rice varieties that can extract P from Pfixing soils with higher P fertilizer use efficiency is considered an important breeding goal. Pup1 (Phosphorous uptake 1) is a major QTL conferring tolerance to the P deficiency under field conditions and is a complex locus~130kb long, probably harbouring many uncharacterized genes [23]. It has been found to occur more in indica rice than in japonica, especially among upland varieties of both the sub-types. Gene based molecular markers K29, K46, K59 and K41spanning the Pup1 locus were used to screen, 105 rice varieties, including major Basmati varieties, with

QTL mapping for grain dimension traits
A mapping population developed from the cross Sonasal x Pusa Basmati 1121 was used to identify QTLs for grain dimension traits. Sonasal is a short grain aromatic rice landrace and Pusa Basmati 1121 is the most popular Basmati rice variety with long slender grains. Phenotyping of 300 F2 plants for grain dimensions before and after cooking was done using F3 seeds harvested from individual plants. Data for grain dimension traits
(milled rice length and breadth, L/B ratio, cooked kernel length and elongation ratio) in 10 seeds/sample were recorded (Table 3). For polymorphism survey between parents >1000 markers (HvSSR, STMS and RGNMS) were used and physical map was generated with genotypic data of 141 markers having genome-wide coverage. A major QTL was mapped for milled rice length explaining phenotypic variance of 74% at 149cM (Fig. 2.) position. At the same position, QTLs for other grain dimension traits namely, milled rice breadth, milled rice length/breadth ratio, cooked kernel length were also mapped (Table 4) explaining phenotypic variance of 19.7 %, 76.5 % and 69.5 % respectively. A QTL for elongation ratio (ER) was also discovered in the marker interval RM130- RM514 spanning a region of 2.04 cM.
in segregating generations. However, the objective evaluation of fragrance using this method is labour intensive and varies from individual to individual and the ability to distinguish between fragrant and nonfragrant samples diminishes with each successive analysis due to saturation of sensory organ and/or physical abrasions to the tongue. A recessive gene badh2 for aroma has been cloned on chromosome 8 [27, 28, 29, 30]. Analysis with the gene based perfect marker has revealed that grain aroma is due to an eight base pair deletion in aromatic varieties compared to non-aromatic varieties [29]. However, these markers, when validated in a set of Basmati and non-Basmati rice genotypes, their efficacy was found to be low. In order to mitigate the problem, another marker nksdel based on BAD2 gene sequence information was designed [31]. This marker was validated on 25 aromatic and 28 non-aromatic rice genotypes with 100% efficacy. In aromatic rice varieties, 82bp fragment was amplified while in case of nonaromatic genotypes a 90bp fragment was amplified (Fig.
Validation and use of fragrance gene linked markers
The aromatic character of Basmati rice has been largely attributed to 2-acetyl-1-pyrroline (2-AP) even though more than 100 volatile aroma compounds have been identified in cooked rice [26]. Sensory evaluation is often carried out by plant breeders to select aromatic plants

Table 3. Trait

Variation for grain dimension traits inF2 population of cross Sonasal X Pusa Basmati 1121. Sonasal Pusa Basmati 1121 Mean 300 F2 population Range 3.63- 8.01 1.60-2.40 1.79-4.70 5.76-15.23 1.00-2.30 CV 18.20 5.89 21.98 21.61 11.54
Milled rice length (mm) Milled rice breadth(mm) Length: breadth ratio Cooked kernel length(mm) Elongation ratio(mm)

2.93 1.56 1.87 5.13 1.75

7.66 1.93 3.95 17.36 2.26

5.30 1.94 2.76 8.86 1.67

Fig. 2. QTL cartographer LOD plot for grain dimension traits on chromosome 3 (each trait is represented as different colours)
May, 2011] Table 4. S.No 7 9
QTLs identified for grain dimension traits on chromosome 3 using composite interval mapping. Trait MRL MRL MRB L/B L/B CKL CKL ER QTL name mrl3_1 mrl3_2 mrb3_1 mrl/b3_1 mrl/b3_2 ckl3_1 ckl3_2 er3_1 Marker interval HvSSR3_28-SF28 SF28- HvSSR3_62 HvSSR3_28- SF28 HvSSR3_28- SF28 SF28- HvSSR3_62 HvSSR3_28-SF28 SF28- HvSSR3_62 RM130- RM514 LOD 58.71 54.13 5.00 45.03 40.63 27.55 24.65 3.04 R
0.74 0.74 0.19 0.76 0.77 0.69 0.70 0.06
MRL: milled rice length, MRB:milled rice breadth, L/B: milled rice length/ breadth ratio, CKL: cooked kernel length, ER: elongation ratio, NLM: nearest left marker, NRM: nearest right marker
3). Further, the marker was also validated in a RIL population consisting of 184 RIL developed from cross (Pusa 1121 x Pusa1342), segregating for aroma, the expected fragment size of 82bp and 90bp were amplified in aromatic and non-aromatic RILs, respectively (Fig. 4).

M 100 bp

Fig. 4. Validation of BADH2 gene based marker (NKSDEL) in F 9 RILs from cross Pusa 1342 X Pusa Basmati 1121. M: 50 base pair DNA ladder, Lanes 1-48: RILs

53 M 100 bp

Conclusion
Fig. 3. Validation of BADH2 gene based marker (NKSDEL) in aromatic/non-aromatic rice genotypes. Aromatic varieties (25 varieties): Bindli (1), Muskan (2), Super Basmati (4), Shah Pasand (9), Ketaki Joha (11), Badshah Bhog (12), Sonasal (17), Type-3 (18), Barasitwa (19), Chini Kamini (20), Lalmati (25), Pusa 1121 (26), Basmati-370 (27), Seond Basmati (34), Dhushura (35), Hasan Sarai (36), Madhumati (40), Pusa Basmati-1 (41), Katak Tara (42), Tilak Chandan (43), Kala Jeera (44), Lal Basmati (49), Kalnamak (50), Taraori Basmati (51), Ramdilal (52). NonAromatic Varieties (28 varieties): Malviya Dhan 36 (3), PNR 136 (5), Jyoti (6), Rasi (7), Red Triveni (8), ADT-37 (10), IRBB-60 (13), IR-36 (14), Ananda (15), Nagina 22 (16), Neela (21), IR 4630 (22), Pusa 44 (23), Sona Mahsuri (24), VL Dhan 221 (28), Pant Dhan 4 (29), TKM-6 (30), Swarna (31), IR 24 (32), IR 20 (33), Krisna Hamsa (37), Sarju 52 (38), Madhu Vijaya (39), Ratna (45), Tetep (46), Vikash (47), Narendra -97 (48), IR-108(53). Note: The figures within parenthesis indicate the lane number

Basmati rice breeding, like all other plant breeding programmes was solely dependent on conventional tools of plant breeding based on phenotypic selection which inspite of achieving significant impacts in Basmati rice improvement was still needing refinements for making progress in breeding for stress resistance. The evolution of reliable molecular marker technologies has provided us a reliable tool by enabling us to map important Basmati quality traits in rice and pyramid genes for stress resistance with impeccable precision through marker assisted selection. Marker assisted breeding has been successfully employed for the development of Improved Pusa Basmati 1 and the improved versions of PRR78 and has become an integral component in the Basmati rice breeding program at IARI, New Delhi. It has been made possible by adopting cost effective MAS strategy complemented by phenotypic selection for precise gene transfer and improvement of Basmati rice varieties. MAS based on molecular markers linked to genes for resistance to biotic
[Vol. 71, No. 2 Fuentes J. L., Jos Correa-Victoria F., Escobar F., Prado G., Aricapa G., Duque M. C., and Tohme J. 2007. Identification of microsatellite markers linked to the blast resistance gene Pi-1(t) in rice. Euphytica, 160: 295-304.
stresses (BB, Blast and BPH), abiotic stress (Salt tolerance and phosphorous use efficiency), grain and cooking quality traits and aroma has enhanced the efficiency and precision of breeding program. Acknowledgements The financial support from following projects for carrying out the work is greatly acknowledged. 1. DBT-ACIP project on development of biotic and abiotic stress resistance in rice. 2. ICAR-Network project on transgenics in crops. 3. NAIP project on Allele mining and expression profiling of Blast resistance genes. References
1. Siddiq E. A., Singh V. P., Zaman F. U., Sadananda A. R., Abraham M. J., Hari Prasad A. S., Anju Mahendru, Natrajan U. S., Nagarajan M., Atwal S. S., Sinha S. N., Chopra N. K., Seth Rakesh, Mahapatra T., Prabhu K. V. and Singh A. K. 2009. Development of high yielding Basmati quality rice varieties. Indian Farming, 59(1): 13-17. Chen S., Liu X., Zeng L., Ouyang D., Yang J. and Zhu X. 2011. Genetic analysis and molecular mapping of a novel recessive gene xa34(t) for resistance against Xanthomonasoryzaepv. Oryzae.Theor. Appl. Genet., 122: 1331-1338. Sharma T. R., Rai A. K., Gupta G. K. and Singh N. K. 2010. Broad-spectrum blast resistance gene Pikhcloned from the rice line Tetep designated as Pi54. J. Plant Biochem. Biotechnol., 19: 87-89. Jena K. K. and Kim S. Current status of Brown Planthopper (BPH) resistance and genetics. 2010. Rice, 3: 161-171. Ronald P. C., Albano B., Tabien R., Abenes L., Wu K. S., McCouch S. and Tanksley S. D. 1992. Genetic and physical analysis of the rice bacterial blight disease resistance locus, Xa21. Mol. Gen. Genet., 236: 113-120. Fjellstrom R., Conaway-Bormans C. A., McClung A. M., Marchetti M. A., Shank A. R. and Park W. D. 2004. Development of DNA markers suitable for marker-assisted selection of three Pi genes conferring resistance to multiple Pyricularia grisea pathotypes. Crop Sci., 44: 1790-1798. Sharma T. R., Shanker P., Singh B. K., Jana T. K., Madhav M. S., Gaikwad K., Singh N. K., Plaha P. and Rathour R. 2005. Molecular mapping of rice blast resistance gene Pi-kh in the rice variety. Tetep. J. Plant Biochem. Biotechnol., 14: 127-133. Eizenga G. C., Agrama H. A., Lee F. N., Yan W. G. and Jia Y. 2006. Identifying novel resistance genes in newly introduced blast resistant rice germplasm. Crop Sci., 46: 1870-1878.

10. Jeon J. S., Chen D., Yi G. H., Wang G. L. and Ronald P. C. 2003. Genetic and physical mapping of Pi5(t), a locus associated with broad-spectrum resistance to rice blast. Mol. Gen. Genomics, 269: 280-289. 11. Wang Z. X., Yano M., Yamanouchi U., Iwamoto M., Monna L., Hayasaka H., Katayose Y. and Sasaki T. 1999. The Pib gene for rice blast resistance belongs to the nucleotide binding and leucine-rich repeat class of plant disease resistance genes. The Plant Journal, 19(1): 55-64. 12. Jairin J., Phengrat K., Teangdeerith S., Vanavichit A. and Toojinda T. 2007. Mapping of a broadspectrum brown planthopper resistance gene, Bph3, on rice chromosome 6. 2007. Mol. Breed., 19: 35-44. 13. Sun L., Su C., Wang C., Zhai H. and Wan J. 2005. Mapping of a major resistance gene to the brown planthopper in the rice cultivar Rathu Heenathi. Breed. Sci., 55: 391-396. 14. Jena K. K., Jeung J. U., Lee J. H., Choi H. C. and Brar D. S. 2006. High-resolution mapping of a new brown planthopper (BPH) resistance gene, Bph18(t), and marker-assisted selection for BPH resistance in rice (Oryza sativa L.). Theor. Appl. Genet., 112: 288297. 15. Rahman M. L., Jiang W., Chu S. H., Qiao Y., Ham T. H., Woo M. O., Lee J., Khanam M. S., Chin J. H., Jeung J. U., Brar D. S., Jena K. K. and Koh H. J. 2009 High-resolution mapping of two rice brown planthopper resistance genes, Bph20(t) and Bph21(t), originating from Oryza minuta. Theor. Appl. Genet., 119: 1237-1246. 16. Thomson M. J., Ocampo M. D., Egdane J., Rahman M. A., Sajise A. G., Adorada D. L., Raiz E. T., Blumwald E., Seraj Z. I., Singh R. K., Gregorio G. B. and Ismail A. M. 2010. Characterizing the Saltol Quantitative Trait Locus for Salinity Tolerance in Rice. Rice, DOI 10.1007/s12284-010-9053-8. 17. Joseph M., Gopalakrishnan S., Sharma R. K., Singh A. K., Singh V. P., Singh N. K. and Mohapatra T. 2004. Combining bacterial blight resistance and Basmati quality characteristics by phenotypic and molecular marker assisted selection in rice. Mol. Breed., 13: 377-387. 18. Gopalakrishnan S., Sharma R. K., Rajkumar K. A., Joseph M., Singh V. P., Singh A. K., Bhat K. V., Singh N. K. and Mohapatra T. 2008. Integrating marker assisted background analysis with foreground selection for identification of superior bacterial blight resistant recombinants in Basmati rice. Plant Breed., 127: 131-139.
19. Basavaraj S. H., Singh V. K., Singh A., Singh D., Nagarajan M., Mohapatra T., Prabhu K. V. and Singh A. K. 2009. Marker aided improvement of Pusa6B, the maintainer parent of hybrid Pusa RH10, for resistance to bacterial blight. Indian J. Genet. Plant Breed., 69(1): 10-16. 20. Basavaraj S. H., Singh V. K., Singh A., Singh A., Singh A., Yadav S., Ellur R. K., Singh D., Gopala Krishnan S., Nagarajan M., Mohapatra T., Prabhu K. V. and Singh A. K. 2010. Marker-assisted improvement of bacterial blight resistance in parental lines of Pusa RH10, a superfine grain aromatic rice hybrid. Mol. Breed., 2: 293-305. 21. Pathak M. D., Cheng C. H. and Fortuno M. E. 1969. Resistance to Nephotettix impictiveps and Nilaparvata lugens in varieties of rice. Nature, 223: 502-504. 22. Gregorio G. B. 1997. Tagging salinity tolerance genes in rice using amplified fragment length polymorphism (AFLP). Ph.D. thesis, University of the Philippines, Los Baos.1997; 118 p. 23. Chin J. H., Lu X., Haefele S. M., Gamuyao R., Ismail A., Wissuwa M. and Heuer S. 2010. Development and application of gene-based markers for the major rice QTL Phosphorus uptake 1. Theor. Appl. Genet., 120(6): 1073-86. 24. Mishra G. P., Singh R. K., Mohapatra T., Singh A. K., Prabhu K. V., Zaman F. U. and Sharma R. K. 2003. Molecular Mapping of a Gene for Fertility Restoration of Wild Abortive (WA) Cytoplasmic

Male Sterility using a Basmati Rice Restorer Line. J. Plant Biochem.Biotech., 12: 37-42. 25. Prakash P. 2003. Molecular mapping of fertility restorer gene(s) and validation of Rf gene linked markers in rice. M.Sc. Dissertation, Indian Agricultural Research Institute. 26. Buttery R. G., Turnbaugh J. G. and Ling L. C. 1988. Contribution of volatiles to rice aroma. J. Agric. Food Chem., 36(5): 1006-1009. 27. Ahn S. N., Bollich C. N. and Tanksley S. D. 1992. RFLP tagging of a gene for aroma in rice. Theor. Appl. Genet., 84: 825-828. 28. Bergman C. J., Delgado D. K., Bryant R., Grimm C., Cadwallader K. R. and Webb B. D. 2002. Rapid gas chromatographic technique for quantifying 2acetyl 1 pyrolline and hexanal in rice (Oryza sativa L.), Cereal Chem., 77: 454-458. 29. Bradbury L. M., Fitzgerald T. L., Henry R. J., Jin Q. and Waters D. L. 2005a. The gene for fragrance in rice. Plant. Biotech. J., 3: 363-370. 30. Bradbury L. M., Henry R. J., Jin Q., Reinke R. F. and Waters D. L. 2005b. A perfect marker for genotyping fragrance in rice. Mol. Breed., 16: 279283. 31. Amrawathi Y., Singh R., Singh A. K., Singh V. P., Mohapatra T., Sharma T. R. and Singh N. K. 2008. Mapping of quantitative trait loci for basmati quality traits in rice (Oryza sativa L.). Mol. Breed., 21: 49-65.