Sharp MD-R3
|
|
Bookmark Sharp MD-R3 |
About Sharp MD-R3Here you can find all about Sharp MD-R3 like manual and other informations. For example: review.
Sharp MD-R3 manual (user guide) is ready to download for free.
On the bottom of page users can write a review. If you own a Sharp MD-R3 please write about it to help other people. [ Report abuse or wrong photo | Share your Sharp MD-R3 photo ]
Manual
Preview of first few manual pages (at low quality). Check before download. Click to enlarge.
Download
(English)Sharp MD-R3, size: 952 KB |
Related manuals Sharp MD-R3H |
Sharp MD-R3
User reviews and opinions
| Hey-U |
3:22am on Monday, October 11th, 2010 ![]() |
| Mine is just fine I have owned this unit for about 3 years. It has been 100% rock solid. I was so surprised to see other people having problems. Mine is just fine I have owned this unit for about 3 years. It has been 100% rock solid. I was so surprised to see other people having problems. | |
Comments posted on www.ps2netdrivers.net are solely the views and opinions of the people posting them and do not necessarily reflect the views or opinions of us.
Documents

MD/CD DECK
OPERATION MANUAL
Thank you for purchasing this SHARP product. For the best performance, read this manual carefully. It will guide you in operating your SHARP product.
FOR YOUR RECORDS
For your assistance in reporting this unit in case of loss or theft, please record below the model number and serial number which are located on the rear of the unit. Please retain this information. Model number ___________________________ Serial number ___________________________ Date of purchase ________________________ Place of purchase ________________________
CAUTION
RISK OF ELECTRIC SHOCK DO NOT OPEN
The lightning flash with arrowhead s y mb o l , w it h i n a n e q u i la t e ra l triangle, is intended to alert the user to the presence of uninsulated dangerous voltage within the products enclosure that may be of sufficient magnitude to constitute a risk of electric shock to persons.
CAUTI ON: TO REDUCE THE RISK OF ELECTRIC SHOCK, DO NO T REM O VE CO VER (OR BACK). NO USER-SERVICEABLE PARTS INSIDE. REFER SERVICING TO QUALIFIED SERVICE PERSONNEL.
The exclamation point within an equilateral triangle is intended to alert the user to the presence of important operating and maintenance (servicing) instructions in the lite rat ure ac company ing the appliance.
Caution - use of controls or adjustments or performance of procedures other than those specified herein may result in hazardous radiation exposure.
WARNING: TO REDUCE THE RISK OF FIRE OR ELECTRIC SHOCK, DO NOT EXPOSE THIS APPLIANCE TO RAIN OR MOISTURE.
WARNING
FCC Regulations state that any unauthorized changes or modifications to this equipment not expressly approved by the manufacturer could void the users authority to operate this equipment.
This equipment has been tested and found to comply with the limits for a Class B digital device, pursuant to Part 15 of the FCC Rules. These limits are designed to provide reasonable protection against harmful interference in a residential installation. This equipment generates, uses, and can radiate radio frequency energy and, if not installed and used in accordance with the instructions, may cause harmful interference to radio communications. However, there is no guarantee that interference will not occur in a particular installation. If this equipment does cause harmful interference to radio or television reception, which can be determined by turning the equipment off and on, the user is encouraged to try to correct the interference by one or more of the following measures: q Reorient or relocate the receiving antenna. q Increase the separation between the equipment and receiver. q Connect the equipment into an outlet on a circuit different from that to which the receiver is connected. q Consult the dealer or an experienced radio/TV technician for help.
q It is the intent of Sharp that this product be used in full compliance with the copyright laws of the United States and that prior permission be obtained from copyright owners whenever necessary. q US and foreign patents licensed from Dolby Laboratories Licensing Corporation.
IMPORTANT SAFEGUARDS
CAUTION All the safety and operating instructions should be read before the appliance is operated, and should be retained for future reference. Electrical energy can perform many useful functions. This unit has been engineered and manufactured to assure your personal safety. Improper use can result in potential electrical shock or fire hazards. In order not to defeat the safeguards, observe the following basic rules for its installation, use and servicing.
Outdoor Antenna Grounding - If an outside antenna is connected to the receiver, be sure the antenna system is grounded so as to provide some protection against voltage surges and built-up static charges. Article 810 of the National Electrical Code, ANSI/NFPA 70, provides information with regard to proper grounding of the mast and supporting structure, grounding of the lead-in wire to an antenna-discharge unit, size of grounding conductors, location of antenna-discharge unit, connection to grounding electrodes, and requirements for the grounding electrode.
EXAMPLE OF ANTENNA GROUNDING AS PER NATIONAL ELECTRICAL CODE
Heed Warnings - All warnings on the appliance and in the operating instructions should be adhered to. Follow Instructions - All operating and use instructions should be followed. Water and Moisture - The appliance should not be used near water - for example, near a bathtub, washbowl, kitchen sink, laundry tub, in a wet basement, or near a swimming pool, etc. Carts and Stands - The appliance should be used only with a cart or stand that is recommended by the manufacturer.
ELECTRIC SERVICE EQUIPMENT
ANTENNA LEAD IN WIRE
GROUND CLAMP ANTENNA DISCHARGE UNIT (NEC SECTION 810-20)
An appliance and cart combination should be
moved with care. Quick stops, excessive force, and uneven surfaces may cause the appliance and cart combination to overturn. Wall or Ceiling Mounting - The appliance should be mounted to a wall or ceiling only as recommended by the manufacturer. Ventilation - The appliance should be situated so that its location or position does not interfere with its proper ventilation. For example, the appliance should not be situated on a bed, sofa, rug, or similar surface that may block the ventilation openings; or, placed in a built-in installation, such as a bookcase or cabinet that may impede the flow of air through the ventilation openings. Heat - The appliance should be situated away from heat sources such as radiators, heat registers, stoves, or other appliances (including amplifiers) that produce heat. Power Sources - The appliance should be connected to a power supply only of the type described in the operating instructions or as marked on the appliance. Power-Cord Protection - Power-supply cords should be routed so that they are not likely to be walked on or pinched by items placed upon or against them, paying particular attention to cords at plugs, convenience receptacles, and the point where they exit from the appliance. Do not use liquid cleaners or aerosol cleaners. Use a damp cloth for cleaning. Power Lines - An outdoor antenna should be located away from power lines.
COAXIAL IN
Digital output etc.
Pin plug Pin plug Commercially available video coaxial cable Pin plug Pin plug
Line input/output, AUX input/output, etc.
PHONES
Connecting cable included with this unit Stereo mini-plug Pin plug Commercially available audio connecting cable
LINE OUT LINE IN L L R R
Headphones etc.
(Continued)
s When making a digital connection When connecting the unit to equipment that has square/round optical jacks:
Connect the other equipment to the OPTICAL jacks on the back of this main unit.
s When making an analog connection When connecting the unit to equipment that has line jacks:
Connect the other equipment to the ANALOG jacks on the back of this main unit.
MD/CD player, etc.
ANALOG
LINE OUT LINE IN
To the optical output jack
AD-M3DC
When its a round optical jack
AD-M1DC
When connecting this unit to other equipment for playback To the optical output jack
Connecting cable included with this unit
To the line input (left) jack
To the line output (left) jack
When connecting this unit to a recorder/player
To the optical input jack
Stereo, DAT, MD recorder, etc. with an optical input/output jack
To the line input (right) jack
q If this unit is connected to a stereo, the digital audio from a CD (or other digital source) can be recorded. When recording from a cassette tape, radio broadcast, etc. an analog connection is required.
Stereo, radio cassette player, etc. with line input/output jacks
To the line output (right) jack
When connecting this unit to equipment that only has a headphone jack:
Connect the other equipment to the "LINE IN jacks" on the back of this main unit.
When connecting this unit to equipment that has a coaxial jack:
Connect the other equipment to the COAXIAL jack on the back of this main unit.
q The coaxial connection is only an input to this unit.
LINE IN
Commercially available audio connecting cable
Commercially available video coaxial cable
To the digital output jack
To the headphone jack
Headphone stereo, radio cassette player, CD player, etc.
s Connecting the AC power cord
If you will not be using this unit for a prolonged period of time, unplug the AC power cord from the AC outlet. Even when the power is turned off, a small amount of current is still consumed. To an AC outlet AC120V, 60 Hz
5 Press the CD 06 button.
The selected CD tray More tracks indica- tion
q Playback will begin from track 1 on the DISC-1. q DISC-1, DISC-2 and DISC-3 will be played continuously in that order. q If you press the CD DIRECT PLAY 2 ( 2) button after pressing the CD button, DISC-2 and DISC-3 will be played continuously. q If you press the CD DIRECT PLAY 3 ( 3) button after pressing the CD button, only DISC-3 is to be played. q If you press the CD button after selecting a track by turning the jog dial, playback will begin on DISC-1, from the track you selected. q After the disc finishes playing, the next disc will be automatically played. q When there is no CD in one of the disc trays, that tray will be skipped, and the next CD will be played. q When all of the tracks on the CDs have been played, the unit will stop automatically.
Total number of Total playing tracks time
Music schedule
To interrupt playback: Press the CD button. Press the CD button to resume playback from the same point. To stop playback: Press the CD s button. To remove the CDs: While in the stop mode, press the
7 button.
s When choosing a CD for playback
Press one of the CD DIRECT PLAY 1 - 3 ( 1 - 3) buttons to select the CD you want to listen to. q Only the selected CD will be played back.
When selecting disc tray 1 When selecting disc tray 2 When selecting disc tray 3
Notes: q If any disc tray is open, it will be automatically closed. q If the CD button is pressed, continuous playback will be performed from the first track of disc 1, even after disc 2 or disc 3 has been selected. Direct playback: If a CD is loaded in the unit, pressing the CD button or any of the CD DIRECT PLAY 1 - 3 ( 1 - 3) buttons turns the power on and begins playback. Cautions: q Do not carry the unit while CDs are in the trays or a MiniDisc is loaded. The discs may come loose inside the unit and be damaged or cause damage to the unit. This may also cause malfunctions. q Do not place two CDs in one disc position. q Do not push the disc trays while they are moving. q Do not attempt to push the disc tray by hand. This may cause malfunctions. q If the power fails while a tray is open, wait until the power supply returns or gently push the tray manually to close it. q If the disc tray is stopped forcibly, "TRAY ERROR" will appear in the display and the unit will not function. If this occurs, turn off the POWER button and turn it on again. q If TV or radio interference occurs during CD operation, move the unit away from the TV or radio. q If a disc is damaged, dirty, or loaded upside down, the disc will be skipped and the next disc will automatically play. q Do not use CDs with tape or loose labels on them, or CDs which have a sticky surface left by tape or labels that have peeled off. If such a CD is inserted, you may not be able to remove the CD or the unit may malfunction. q If the CD button, any of the CD DIRECT PLAY ( 1 - 3) buttons or the 7 button is pressed when a disc tray is open, the disc tray will be automatically closed. Be careful not to catch your finger.
To search very quickly:
When fast forward or fast reverse is used while in the pause mode, the playback point will move more quickly than when using audible fast forward or audible fast reverse playback. q In this mode, no sound is heard. Therefore, you must refer to the time display. q When you lift your finger, the unit will re-enter the pause mode.
The elapsed playing time is reduced.
s Repeat play and random play
(Remote control operation)
The elapsed playing time is increased.
Select the desired program source, CD or MD, by pressing the CD s or MD s button. Press the PLAY MODE button.
q Each time this button is pressed, the mode will change in the following order: Repeat play Random play Normal play
PLAY MODE
3 Press the 06 button to start playback.
q When all of the tracks have been played in random order, the unit will stop automatically.
To stop playback:
Press the CD s or MD s button.
To cancel repeat play or random play:
Press the PLAY MODE button until or RANDOM disappears.
To repeat playback of selected tracks:
Enter the program for the tracks you want and start repeat play. You can program a single track and play it repeatedly. Notes: q During APMS play, random play is not possible. q When repeat or random play is selected while a CD or MD is playing, repeat or random play will start at that point.
REPEAT indicator
RANDOM
RANDOM indicator
When more than one CD is inserted: When you press the CD button. q All of the CDs in the unit will be played repeatedly or randomly. (Playback will continue until the unit is stopped manually.) If you press any of the buttons: Only tracks from the selected CD will be played repeatedly or randomly. q When all of the tracks have been played in random order, the unit will stop. (None of the tracks is played twice.)
PROGRAM
s APMS
(Automatic Programmable Music Selector)
1 Select the desired program source, CD or MD, by pressing
the CD s or MD s button.
2 Press the PROGRAM button while in the stop mode.
q Programs cannot be set or canceled while in the playback or pause mode.
you have selected CD, press one of the buttons ( 3) to select the disc to be played.
Select a desired track number by pressing the DIRECT KEY button on the remote control.
q If the total program playing time exceeds 199 minutes and 59 seconds, : will appear. However, the programmed selections will still be memorized.
5 Repeat 2
steps 3 and 4 for any other tracks. Up to 20 MD tracks or 32 CD tracks can be programmed.
PRGM indicator
q To select a track on an MD or on the same CD, skip step 3. q The programmed playback order and the total playing time of the programmed tracks will be displayed automatically, and only those track numbers will appear in the music schedule.
6 Press the CD s or MD s button. 7 Press the CD 06 or MD 06 button to start playback of the
programmed selections.
q After all of the programmed tracks have finished playing, the unit will automatically stop.
To clear the programmed selections:
Press the DELETE/CLEAR (CLEAR) button while the PRGM indicator is flashing. q Each time the button is pressed, one track will be cleared, beginning with the last track programmed.
Total playing time
To cancel the APMS:
While the unit is stopped in the APMS mode, press the CLEAR button on the remote control to turn off PRGM. When you use the DELETE/CLEAR button on the main unit, all of the programmed contents will be erased by holding it down for at least 2 seconds. (If you simply press this button briefly, the unit will enter the timer mode.) q The program contents will be erased. q When you open the disc tray or a MiniDisc is removed, the APMS mode will be canceled.
To check which tracks are programmed:
PRGM will disappear.
While the unit is stopped in the APMS mode, turn the jog dial. Or press the or button on the remote control. q When the jog dial is turned clockwise, the next track number will appear. When it is turned counterclockwise, the previous track number will appear.
To add tracks to the APMS:
When a program has been entered ("PRGM" will be lit), perform steps 2 - 6. Additional tracks can be selected and they will be stored after the last track you entered.
The playing time will appear about 2 seconds later.
Notes: q It is not possible to insert an additional track between programmed tracks that have already been entered. q Programming and canceling are not possible during playback or in the pause mode.
TRACK/DISC NAME
You can assign titles to recorded tracks and to discs. The characters must be capital and lowercase letters, or symbols. Track and disc names can use up to 100 characters per name. (Page 31)
s Using the editing function
We will show you some examples of how to use the editing functions. You can create a disc of your favorite selections by recording tracks from a variety of input sources such as CDs, tapes, and radio broadcasts.
STEP 1
Recording tracks to be edited on an MD Digital recording from a CD Recording a broadcast Analog recording from tape
Live performance
STEP 2
Putting the space between tracks in order
The tracks are combined using the combine function. A B C D
The tracks are divided using the divide function. Talk E F G CM H
STEP 3
Cutting unnecessary sections
Cut using the erase function.
Cut using the erase function. G H
Rearranging tracks in your preferred order
The tracks are rearranged using the program move function. D E A C B H
The track is moved using the move function. F G
STEP 5
Finish by putting names on the disc and tracks
(Disc name)
(Track name)
The editing functions are selected from the edit menu. The functions which can be selected from the edit menu will vary, depending on the state in which an editing operation is started.
STEP 1 Edit menu display
/ NAME/TOC EDIT
STEP 2 Edit menu selection Previous menu Next menu
STEP 3 Editing start
Each time the button is pressed, the edit menu will appear.
(Move function)
Each time the dial is turned, the next menu will appear in order.
(Track name function)
You can edit the selected menus.
A different menu may be displayed.
Within 10 seconds, perform step 3.
To stop editing anytime, press the MD button.
This function
Can be selected in the following conditions.
Disc name Track name Divide Combine Move Program move Erase All erase
When stopped The total number of tracks appears
When stopped Selection of track numbers
During playback
Playback in the pause mode
During recording/ in the recording stand-by mode
When entering a program
Yes No No No No No No Yes
No Yes No Yes Yes No Yes No
No Yes No No No No No No
No Yes Yes Yes Yes No Yes No
No No No No No Yes No No
ENTER NAME/TOC EDIT
s DIVIDE
1 Play the track which you want to divide into two, and press
the MD track. q The unit will enter the pause mode.
06 button at the point where you want to divide the
2 Press the NAME/TOC EDIT button, and then select DIVIDE
using the jog dial.
3 Within 10 seconds, press the ENTER button. 1
(To name the first track)
4 Select the character you want using the jog dial. 5 Press the ENTER button to enter the character.
q Repeat steps 3 to 5 above to enter characters in the name. When the next characters type is the same as the previous character, step 3 can be skipped.
6 After entering all of the characters in the name, press the
NAME/TOC EDIT button. q The track name will be recorded. q The unit will return to normal playback.
(If you have selected capital letters)
(If you select L)
Track name recorded
Notes: q This function cannot be used while in the program ("PRGM" is lit: Page 15) or random play mode ("RANDOM" is lit: Page 14). First, cancel the program or random play mode before trying to use this function. q The track name function can be used while in the stop mode (when selecting a track), in the pause mode, or in the recording mode. (Select TRACK NAME from the edit menu.) q If you create a track name while recording the track, make sure you finish entering the name before you finish recording the track. If the end of the recording is reached before you have entered the complete name, only the characters entered before the recording ended will be recorded.
s To erase track names
After performing steps 1 to 2 mentioned above, do the following to erase a track name:
Press the DELETE/CLEAR button for at least 2 seconds. Press the ENTER button.
q "NAME CLEAR?" will appear. q The track name will be erased.
s To change disc names and track names
To change disc names:
1 During playback, press the MD s button. 2 Press the NAME/TOC EDIT button. 3 Within 5 seconds, press the ENTER button.
q The unit will enter the character input mode. q To cancel this operation, press the MD s button. Now you can erase or add characters. (Page 35)
To change track names:
1 While in the stop mode, select the track name you want to
change, using the jog dial.
2 Press the NAME/TOC EDIT button. 3 Within 5 seconds, press the ENTER button.
DISPLAY/CHARACTER NAME/TOC EDIT DELETE/CLEAR TIMER
s To erase a character
After performing steps 1 to 3 on page 34, do the following to erase unwanted characters: Example: To change BESUT to BEST
4 Press the
/ button to make the character you want to erase begin flashing.
(To erase the letter "U")
5 Press the DELETE/CLEAR button. 6 Press the NAME/TOC EDIT button.
q The character will disappear.
s To add a character
After performing steps 1 to 3 on page 34, do the following to add additional characters:
(To add a character to left of the "S")
Example: To change BST to BEST
(Timer standby mode)
Timer playback indicator
s Timer recording
Before timer recording, the following preparations are required. q Load a recordable MD.
"TIMER REC" using the jog dial.
3 Press the ENTER button.
5 Enter the minute, using the jog dial. Then, press the ENTER
button. q The stop time setting display will appear.
6 Enter the hour, using the jog dial. Then, press the ENTER
ANALOG DIGITAL OPT DIGITAL COAX q If you select the analog input, adjust the recording level. (Page 22)
Setting timer for recording:
1 Press the TIMER button, and then select "T-STANDBY" using
the jog dial.
q The settings will appear in order, and the unit will enter the timer recording stand-by mode. (The power will be turned off.)
Preparations for any equipment connected to this unit Any equipment, such as a stereo, that is connected to this unit should be set up in advance as follows: q Set it up so that music to be recorded will be played at the same time as the timers start time. When the digital optical input was selected
(Timer stand-by mode)
Timer recording indicator
s To check the timer setting
1 While in the timer stand-by mode, press the TIMER button. 2 Turn the jog dial until TIMER CALL appears. 3 Press the ENTER button within 10 seconds.
q The timer settings will appear in order, and then the original display will reappear.
(Timer confirmation mode)
s To cancel the timer operation
When the power is turned on, the timer will be canceled. The timer operation can also be canceled as follows.
(Timer cancel mode)
1 While in the timer stand-by mode, press the TIMER button. 2 Turn the jog dial until TIMER CANCEL appears. 3 Press the ENTER button.
q The timer operation will be canceled. ("TIMER" or TIMER REC will go out.) The start and stop times will still be stored. Notes: q When the CD or MD is played to the end, playback will stop before the stop time. If you wish to play to the stop time, set repeat play for the CD or MD. q This timer in this unit cannot be used to control equipment connected to this unit. You must use the timer in the other equipment, if it has one. q The timer playback and timer recording functions cannot be used at the same time. In q q q the following cases, the timer recording function will not work. When a MiniDisc has not been inserted. When a playback-only MiniDisc is inserted. When the MiniDisc you inserted is protected against accidental erasure. q When there is no recording space left on the MiniDisc you inserted (when the "TOC FULL" or "DISC FULL" messages appear).
s High-speed access
A unique feature of the MiniDisc is the ability to locate the beginning of a desired track at high speed. This is because the track number and track name data is stored in a TOC (Table of Contents).
A shutter will be used on only one side (back).
TOC Sound data
q Recordable MiniDisc: This is a raw disc on which recording can be performed. A magneto optical disc is used. Recordings are made using a laser and magnetic field. Repeated recording is possible.
s Shock Resistant Memory
During playback, approximately 10 seconds of information is stored in the semiconductor memory. Therefore, even when the pickup cannot read information for a second or two due to an external shock, the sound continues without interruption because the information stored in memory is output.
Shutters will be used on both sides.
MINIDISC SYSTEM LIMITATIONS
"TOC FULL" may be displayed even if the maximum recording time on a MiniDisc has not been reached. In the MD system, the recording area on an MD is programmed in a TOC (Table of Contents). If tracks are recorded, edited and partial erased repeatedly, the TOC will fill up with information about the tracks, even though the track limit (255 tracks) has not been reached. If that happens, further recording will be impossible. (If you use the all erase function, the MD can be reused as a blank MD.) If there is a flaw on the MiniDisc surface, that area is automatically excluded from the space available for recording. Therefore, the available recording time will be reduced. When the remaining recording time of a disc is displayed, short tracks less than 8 seconds long may not be included in the total. For MiniDiscs which repeated recording and editing operations were performed, the COMBINE function may not work. Tracks recorded from a CD (digital recordings) and tracks recorded from some other equipment (analog recordings) cannot be combined. A cluster (about 2 seconds) is normally the minimum unit of recording. So, even if a track is less than 2 seconds long, it will use about 2 seconds of space on the disc. Therefore, the time actually available for recording may be less than the remaining time displayed. If there are scratches on discs, those sections will be automatically avoided (no recording will be placed in those sections). Therefore, the recording time will be reduced. An MD which has been recorded or edited repeatedly may skip during fast reverse or fast forward.
Even if the maximum MiniDisc recording time has not been reached, "DISC FULL" may be displayed. Even if several short tracks are erased, the remaining recording time may not show an increase. Two tracks may not be combined in editing.
The total of the recorded time and time remaining on a disc may not add up to the maximum possible recording time.
If you fast reverse or fast forward over recorded tracks, the sound may skip.
TROUBLESHOOTING
s If a problem occurs
If this unit functions abnormally during operation, first check the following items. If the unit continues to function abnormally, or if an abnormality appears other than listed below, turn off the players power and disconnect the AC power plug, then consult your SHARP dealer or service personnel.
General
SYMPTOM
The clock is wrong. When a button is pressed, the unit does not respond. Radios make unusual noise or the picture on the TV screen is distorted. When a radio or TV which uses an indoor antenna is placed near the unit, the picture on the TV screen may be distorted or the radio may not function properly.
POSSIBLE CAUSE
Did a power failure occur?
REMEDY
Try setting it again. Turn the power off and on again, and then retry the operation. It is recommended that you use an outdoor antenna.
CD playback
SYMPTOM POSSIBLE CAUSE
Clean the disc.
Load the disc with the correct side up.
Even though a disc has been loaded, "NO The disc is loaded up-side down. DISC" or "ERROR" is displayed. The disc is very dirty.
Load the correct disc. Playback stops in the middle of a track, The disc does not satisfy the standards. Is the unit located near excessive vibra- Place the unit on a firm, level surface free or playback is not performed properly. tions? from vibration. Playback sounds are skipped. Has condensation formed inside the unit? Remove the disc and leave the power turned on. The unit should function properly in about 1 hour.
MD recording and playback
A recording cannot be made.
Is the MiniDisc protected against accidental erasure? Did you try to record on a playback-only MiniDisc? Can you see the TOC FULL message in the display?
Slide the accidental erase prevention tab back to its original position. Replace it with a recordable disc. Put in another recordable disc with recording space on it. Replace the disc. Place the unit on a firm, level surface free from vibration. Place the unit on a firm, level surface free from vibration. Remove the disc and leave the power turned on. The unit should function properly in about 1 hour.
Even though a disc has been loaded, NO DISC or ERROR is displayed.
Is the disc scratched?
Is the unit located near excessive vibration? Is the unit located near excessive vibrations? Has condensation formed inside the unit?
Playback stops in the middle of a track, or playback is not performed properly. Playback sounds are skipped.
Remote control
The remote control does not function or does not operate properly.
The batteries (polarity) are not inserted properly. The batteries inside the remote control are dead. The remote control is operated from an incorrect distance or angle. No disc has been loaded.
Insert properly. Replace the batteries. Operate it within a range of 8" (0.2 m) to 20 (6 m) and within an angle of 15 o to either side of center. Load a disc. Connect the AC power cord.
The power cannot be turned on from the remote control.
Is the AC power cord plugged in?
When an error message is displayed, proceed as follows:
Error messages Meaning Remedy
BLANK MD
q Nothing is recorded. (Neither music nor a disc name have been recorded on this MD.) q You tried to record from a disc which you are not allowed to copy. q A track cannot be edited. q Recording cannot be performed correctly due to vibration. q Since this disc has scratches on it, the recording operation was skipped. q The CD changer is not working properly.
q Replace the disc with a recorded disc.
Cant COPY Cant EDIT Cant REC DEFECT CH ERROR
q Replace it with another disc which you can copy from (regular CD). q Change the stop position of the track and then try editing it. q Move the unit away from the source of vibration. q Replace the disc with another recordable disc. q Press the POWER button to turn off the power, and disconnect the AC power cord from the AC outlet. Then connect the AC power cord, and turn on the power again. q Connect correct digital signals. q Use the analog input jack. q Reload the disc or replace it. q Replace the disc with another recordable disc. q Replace the MD with another recordable disc. q Reload the MiniDisc. q Contact your nearest authorized Sharp servicer. q Press the POWER button to turn off the power, and press the button.
Din UNLOCK DISC ERR DISC FULL EDIT OVER FOCUS ERROR MD ERROR MECHA ERR* NAME FULL *NO DISC* NOT AUDIO PLAYBACK MD
q Incorrect digital signals are input. q The disc is damaged or there is no TOC on the disc. q The disc is out of recording space. q There is no space left to record the remainder of the CD. q The proper focus cannot be obtained. q The unit is malfunctioning and will require service. q There is a mechanical problem and the disc is not working properly. q The number of characters for the disc name or track name exceeds 100. q A disc has not been loaded. q The disc data cannot be read. q The data recorded on this disc is not audio data. q You tried to record on a playback-only disc. q The data of disc names and track names are not able to move from playback-only discs. q The MiniDisc is write protected. q The temperature is too high. q The disc has a large amount of damage. q TOC information cannot be read. q The MD does not meet the specifications for MDs. q There is no space left for recording character information (track names, disc names, etc.) q The unit is malfunctioning and will require service. q The TOC information on this disc does not meet the MD specifications or it cannot be read. q The TOC information could not be created properly due to a mechanical shock or to scratches on the disc. q The data contains an error. q Music is not being recorded.
q Shorten the disc or track name. q Load a disc. q Reload the disc. q Select another track. q Replace the disc. q Replace it with a recordable MiniDisc. q Edit only the sound. q Move the write protection tab back to its original position. q Press the POWER button to turn off the power. Allow the unit to cool for a while. q Replace the disc with another disc.
PROTECTED TEMP OVER TOC ERR*
TOC FULL* TOC W ERROR U TOC ERR* U TOC W ERR
q Replace it with another recordable disc. q Contact your nearest authorized Sharp servicer. q Replace it with another disc. q Erase all the data, and try recording. q Press the POWER button to turn off the power, and try to write the TOC again. (Remove any source of shock or vibration while writing.) q Replace the disc with another disc. q Replace the disc with a recordable disc.
? DISC 0 0:00
*: Number or symbol
s Moisture condensation
In the following cases, condensation may form inside the unit. q Shortly after turning on a heater. q When the unit is placed in a room where there is excessive steam or moisture. q When the unit is moved from a cool place to a warm place. When the unit has condensation inside, the disc signals cannot be read, and the product may not function properly. q If this happens, remove the disc, and open the disc tray. The condensation should evaporate in approximately 1 hour. The unit will then function properly.
If this product is subjected to strong external interference (mechanical shock, excessive static electricity, abnormal supply voltage due to lightning, etc.) or if it is operated incorrectly, it may malfunction or the display may not function correctly. If such a problem occurs, do the following:
Unplug the AC power cord from the AC outlet. Wait about 20 - 30 seconds and then plug the AC power
cord back into the AC outlet.
Press the RESET button on the back of the unit.
Pen, pencil, etc.
s If a power failure occurs during recording
If the AC power plug is disconnected from the AC outlet or a power failure occurs during recording (before the TOC information has been recorded on the disc), the audio portion being recorded at that time will be erased. When a recording is being added to a MiniDisc which already has a recording on it, and the TOC is not updated before the power failure, the added recording will be erased. q If a power failure occurs or the AC power cord is disconnected for about 10 minutes, the TOC will be written on the disc when power is restored. q When the RESET button is pressed, all of the settings in memory will be erased. q If strange sounds, smells or smoke come out of the unit or if a foreign object falls into the unit, turn off the power and unplug the AC power cord from the AC outlet, immediately. Contact your nearest authorized Sharp servicer.

THE JOURNAL OF BIOLOGICAL CHEMISTRY 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
Vol. 278, No. 51, Issue of December 19, pp. 5108551090, 2003 Printed in U.S.A.
Farnesoid X Receptor Activates Transcription of the Phospholipid Pump MDR3*
Received for publication, July 30, 2003, and in revised form, October 1, 2003 Published, JBC Papers in Press, October 2, 2003, DOI 10.1074/jbc.M308321200
Li Huang, Annie Zhao, Jane-L. Lew, Theresa Zhang, Yaroslav Hrywna, John R. Thompson, Nuria de Pedro, Inmaculada Royo, Richard A. Blevins, Fernando Pelaez, Samuel D. Wright, and Jisong Cui**
From the Departments of Atherosclerosis and Endocrinology, Bioinformatics, and Molecular Profiling, Merck Research Laboratories, Rahway, New Jersey 07065 and Merck Sharp and Dohme de Espana, S. A. Josefa Valcarcel 38, 28027 Madrid, Spain
The human multidrug resistance gene MDR3 encodes a P-glycoprotein that belongs to the ATP-binding cassette transporter family (ABCB4). MDR3 is a critical trans-locator for phospholipids across canalicular membranes of hepatocytes, evidenced by the fact that human MDR3 deficiencies result in progressive familial intrahepatic cholestasis type III. It has been reported previously that MDR3 expression is modulated by hormones, cellular stress, and xenobiotics. Here we show that the MDR3 gene is trans-activated by the farnesoid X receptor (FXR) via a direct binding of FXR/retinoid X receptor heterodimers to a highly conserved inverted repeat element (a FXR response element) at the distal promoter (1970 to 1958). In FXR trans-activation assays, both the endogenous FXR agonist chenodeoxycholate and the synthetic agonist GW4064 activated the MDR3 promoter. Deletion or mutation of this inverted repeat element abolished FXR-mediated MDR3 promoter activation. Consistent with these data, MDR3 mRNA was significantly induced by both chenodeoxycholate and GW4064 in primary human hepatocytes in time- and dose-dependent fashions. In conclusion, we demonstrate that MDR3 expression is directly up-regulated by FXR. These results, together with the previous report that the bile salt export pump is a direct FXR target, suggest that FXR coordinately controls secretion of bile salts and phospholipids. Results of this study further support the notion that FXR is a master regulator of lipid metabolism.
ATP-binding cassette (ABC)1 transporters constitute a large family of proteins, and many have been shown to be involved in lipid transport. MDR3 (ABCB4), a P-glycoprotein, is predominantly expressed in the liver (1) and is the critical trans-locator
* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) M23234. ** To whom correspondence should be addressed: Dept. of Atherosclerosis and Endocrinology, Merck Research Laboratories, 126 E. Lincoln Ave., P. O. Box 2000, RY80W-107, Rahway, NJ 07065. Tel.: 732-5946369; Fax: 732-594-7926; E-mail: jisong_cui@merck.com. 1 The abbreviations used are: ABC, ATP-binding cassette; FXR, the farnesoid X receptor; FXRE, FXR response element; MDR, multidrug resistance; CDCA, chenodeoxycholate; RXR, retinoid X receptor ; BSEP, the bile salt export pump; IR-1, inverted repeat separated by a single nucleotide; EMSA(s), electrophoretic mobility shift assay; FBS, fetal bovine serum; CS-FBS, charcoal-stripped FBS; DMEM, Dulbeccos modified Eagles medium; MOPS, 4-morpholinepropanesulfonic acid; RA, retinoic acid.
This paper is available on line at http://www.jbc.org
for phospholipids across canalicular membranes of hepatocytes (2). The MDR3 function is essential for the liver as evidenced by the fact that MDR3 deficiencies in humans result in progressive familial intrahepatic cholestasis type III (3, 4). A number of factors, such as hormones, cellular stress, and xenobiotics have been shown to modulate MDR3 expression (57). However, the underlying molecular mechanisms for MDR3 gene regulation are unclear. In this study, we demonstrate that the bile acid receptor FXR directly regulates expression of MDR3. FXR is a nuclear receptor for bile acids and regulates expression of a number of genes in which products are critically important for bile acid and cholesterol homeostasis (8 11). FXR functions as a heterodimer with the 9-cis-retinoic acid receptor (RXR) (12, 13), and the FXR/RXR heterodimer activates gene transcription via binding to a specific DNA sequence comprised of two inverted hexamer repeats separated by one nucleotide (IR-1) in the target promoter. To date, there is only one reported case in which FXR down-regulates apolipoprotein A-I expression via a FXR monomer or homodimer binding to an IR-1 (14). Previous studies (15, 16) have shown that agonist-bound FXR directly regulates expression of the bile salt export pump (BSEP), an ABC transporter (ABCB11) in which deficiencies also cause progressive familial intrahepatic cholestasis (type II) (3). We hypothesized that FXR might also regulate expression of MDR3 to coordinately control secretion of bile acids and phospholipids. To determine whether the MDR3 gene is a target of FXR, we first treated primary human hepatocytes with FXR agonists and analyzed endogenous MDR3 expression by real time PCR and by Northern blot analysis. Indeed, in primary human hepatocytes, the MDR3 mRNA was strongly induced by both the endogenous FXR agonist CDCA and the synthetic ligand GW4064. We further identified an IR-1 element in the MDR3 promoter and demonstrated that the FXR/RXR heterodimer specifically bound to the IR-1 and that the integrity of this IR-1 is essential for FXR-mediated promoter activation. These results indicate that the human MDR3 gene is directly transactivated by FXR via the IR-1 element in the MDR3 promoter and suggest that FXR regulates expression of MDR3 and BSEP coordinately by a feed-forward mechanism to facilitate hepatic export of bile acids and phospholipids. These results support the critical role of FXR in cholesterol and bile acid metabolism.
MATERIALS AND METHODS
Downloaded from www.jbc.org by guest, on June 7, 2011
ReagentsThe following reagents were obtained from Invitrogen: DMEM and Opti-MEM I medium, regular fetal bovine serum (FBS) and charcoal-stripped FBS (CS-FBS), TRIzol reagents, T4 polynucleotide kinase, PCR Supermix, and oligonucleotide primers for gene cloning.
FXR Regulation of MDR3 Expression
[-32P]ATP (3000 mCi/mmol) was obtained from Amersham Biosciences. The TNT T7 quick-coupled transcription/translation kit and reagents for -galactosidase and luciferase assays were purchased from Promega (Madison, WI). The QuikChange mutagenesis kit was obtained from Stratagene. FuGENE 6 transfection reagent was obtained from Roche Diagnostics. CDCA was obtained from Steraloids, Inc. (Newport, RI). TaqMan reagents for cDNA synthesis and real time PCR and TaqMan oligonucleotide primers and probes for human MDR3 were purchased from Applied Biosystems (Foster City, CA). Sequence Analysis of MDR3 Genomic RegionPrevious study has identified multiple transcription start sites for human MDR3 (17). To better define the transcription start site of MDR3, we blasted the predominant form of the gene, NM_000443, against human mRNA and EST data bases. Multiple transcripts of human MDR3 were identified and retrieved. Each of them was mapped onto the Celera human genome (R26) using BLAT (18). The map indicated two transcription start sites 5 kb apart. Based on information from the full-length transcripts, we refer to the upstream site as the transcription start site of human MDR3. The genomic region spanning MDR3 and its 10-kb upstream flanking region was then extracted. Putative binding sites for transcription factors were identified by scanning this genomic sequence against the TRANSFAC data base (19) and the position-weighted matrices constructed internally. MDR3 Promoter and Reporter Plasmid ConstructsComparison of human MDR3 cDNA sequence by the BLAST search identified the genomic region spanning MDR3 and its 10-kb upstream-flanking region. The fragment of 2201/37 was amplified by PCR, and the MDR32201-Luc construct was generated by subcloning of the PCR-amplified fragment (2201/37) into the pGL3-enhancer plasmid vector (Promega) at NheI/HindIII sites. Similarly, the MDR32000-Luc and MDR31955-Luc constructs were also generated by subcloning of the PCR-amplified fragment (2000/37) and (1955/37) into the pGL3enhancer plasmid, respectively. The sequence integrity for all constructs was confirmed by DNA sequencing. The expression vector pcDNA3.1-hFXR, pcDNA3.1-hRXR, and pCMV-lacZ were described previously (20). MDR3 Promoter MutantsFXRE in the MDR3 promoter was mutated using the QuikChange mutagenesis kit (Stratagene). PCR reactions were carried out according to the manufacturers directions with the MDR32000-Luc construct as a template. The sense primer was 5-AG AGT TAG TAA A AATCA A TAATTT TAAGCC TAG TG-3, and the antisense primer was 5-CA CTA GGC TTA AAATTA T TGA TTT TT A CTA ACT CT-3 (altered bases are in bold and underlined). Electrophoretic Mobility Shift Assay (EMSA)cDNA encoding human FXR or RXR was transcribed and translated using the TNT quick-coupled transcription/translation system (Promega) according to the instructions of the manufacturer. Double-stranded oligonucleotide probes for the EMSA were end-labeled with [-32P]ATP (3000 mCi/ mmol) by T4 polynucleotide kinase. The EMSA was performed as described previously (21) with minor modifications. Briefly, 2 l of in vitro translated FXR or RXR protein alone or together were added to 20 l of reaction containing 10 mM Tris (pH 8.0), 40 mM KCl, 0.05% Nonidet P-40, 6% glycerol, 1 mM dithiothreitol, 1 g of poly(dI-dC). Cold competitor oligonucleotides including the wild type MDR3 FXRE (5-AGT TAG TAA ATGTCAATAACCT TAAGC-3), mutated MDR3 FXRE (5-AG AGT TAG TAA A aaTCA A TAAttT TAAGCC TAG TG-3) and ideal IR-1 containing an IR-1 consensus (5-GATGGGCCA AGGTCA A TGACCT CGGGG-3) were included in 20-, 50-, and 200-fold excess. After a 20-min incubation on ice, 10 fmol of the 5-end-labeled MDR3 FXRE probes were added, and the mixture was continuously incubated for an additional 20 min on ice. DNA-protein complexes were resolved on a 4% native polyacrylamide gel electrophoresis containing 0.5 Tris borate-EDTA (0.89 M Tris, 0.89 M boric acid, 0.02 M disodium EDTA for 10 Tris borate-EDTA). The gel was dried and exposed to x-ray film at 70 C. FXR Trans-activationHepG2 cells were transfected in 96-well plates using the FuGENE 6 transfection reagent as described previously (22). Transfection mixtures for each well contained 0.405 l of FuGENE 6, 10.4 ng of pcDNA3.1-hFXR, 10.4 ng of pcDNA3.1-hRXR, 10.4 ng of pGL3-enhancer-MDR3-promoter-Luc, and 103.8 ng of pCMVlacZ. The treatment of transfected cells with various FXR ligands, assays for luciferase, and -galactosidase activities were performed following the same protocols as described previously (22). This assay was performed at Merck Sharp and Dohme de Espana in Spain. Treatment of Primary Human Hepatocytes for Gene Expression Primary human hepatocytes were purchased from In Vitro Technologies. Cells were maintained in DMEM containing 10% FBS, 1% penicillin/streptomycin, 1 mM sodium pyruvate, and 5 mM HEPES. For
FIG. 1. Induction of human MDR3 mRNA by FXR agonists in primary human hepatocytes. A and B, primary human hepatocytes at a density of 2 million cells/well in 6-well plates were treated with 60 M CDCA (hatched bars) or 5 M GW4064 (solid bars) at various time points (A) or with various concentrations of CDCA (B) for 24 h in DMEM containing 0.5% CS-FBS. Total RNA was prepared, and MDR3 mRNA was analyzed by TaqMan PCR as described under Materials and Methods. Results are normalized as the -fold of control (treated cells versus vehicle). Each value represents the mean S.D. of duplicate three determinations. C, Northern blot analysis for induction of human MDR3 mRNA by FXR agonists. Total RNA was isolated from primary human hepatocytes as described under Materials and Methods, and 10 g were separated on a 1% agarose/formaldehyde gel, transferred to a nylon membrane, and hybridized to the MDR3 or -actin radiolabeled cDNA probe as described under Materials and Methods. DMSO, Me2SO. determination of gene specific expression by TaqMan analysis, cells were seeded in 6-well plates at a density of 2 million cells/well in DMEM containing 10% FBS, 1% penicillin/streptomycin and 5 mM HEPES. Twenty-four hours after seeding, cells were treated with various concentrations of compounds in DMEM containing 0.5% CS-FBS, 1% penicillin/streptomycin, and 5 mM HEPES. Unless specified, cells were treated for 24 h. RNA Isolation and Real Time Quantitative PCRTotal RNA was extracted from the treated human primary hepatocytes using the TRIzol reagent according to the manufacturers instructions. Reverse transcription reactions and TaqMan PCRs were performed according to the manufacturers instructions (Applied Biosystems). Sequence-specific amplification was detected with an increased fluorescent signal of carboxyfluorescein (reporter dye) during the amplification cycles. Amplification of human 18 S RNA was used in the same reaction of all samples as an internal control. Gene-specific mRNA was subsequently normalized to 18
FIG. 2. FXR/RXR heterodimers bind specifically to the IR-1 element in the human MDR3 promoter. A, EMSAs were performed as described under Materials and Methods with in vitro translated FXR (lane 1), RXR (lane 2), or FXR/RXR (lanes 312) with the wild type (WT) IR-1 in the human MDR3 promoter as probe. Competition analysis was performed with a 20-, 50-, or 200-fold excess of wild type MDR3 IR-1 (lanes 4 6), mutated IR-1 (Mut, lanes 79), or idealized IR-1 (lanes 10 12). Sp, specific DNAprotein complex. B, the sequences of oligonucleotides used in this study.
S RNA. Levels of human MDR3 mRNA were expressed as the -fold difference of compound-treated cells against Me2SO-treated cells. Northern Blot AnalysisIsolation of total RNA was similar to that used in real time quantitative PCR. Total RNA (10 g) was separated by electrophoresis on a 1% denaturing agarose gel with 1 formaldehyde/MOPS (Ambion, TX) and then transferred to a nylon membrane (Nytran SuPerCharge, Schleicher and Schuell). Blots were hybridized with 32P-labeled cDNA probe of the human MDR3 gene (GenBank accession number M23234, bases 536 1129) and then re-probed with a radiolabeled cDNA probe of the -actin gene (Ambion, TX). TaqMan Primers and ProbesOligonucleotide primers and probe for human MDR3 were designed using the Primer Express program and were synthesized by Applied Biosystems. These sequences (53) are as follows: forward primer (GTACTGGTGCACTTTCTACAAGACTTG), probe (6FAM-CACAGATGCTGCCCAAGTCCAAGGA-TAMRA), and reverse primer (TGCAATTAAAGCCAACCTGGTT) (where 6FAM is 6-carboxyfluorescein and TAMRA is carboxytetramethylrhodamine). The primers and probe for human 18 S RNA were also purchased from Applied Biosystems.
RESULTS
Endogenous Expression of MDR3 Is Increased by FXR Agonists in Primary Human HepatocytesTo determine whether MDR3 expression is regulated by FXR, primary human hepatocytes were treated with the endogenous FXR agonist CDCA (60 M) and the synthetic FXR agonist GW4064 (5 M) for 3, 6, 12, 24, and 48 h, and the endogenous expression of MDR3 was determined by real time PCR (TaqMan). Up-regulation was readily detectable within 3 h with a maximum induction of 1.52-fold, which increased to around 3-fold at 6 h and about 4-fold at 12 h (Fig. 1A). Twenty-four-hour treatment yielded a peak induction of 5 6-fold, which decreased slightly at 48 h (Fig. 1A). The fact that MDR3 up-regulation by FXR agonists was readily detectable as early as 3 h suggests MDR3 is a direct target of FXR. Upon 24-h treatment, MDR3 mRNA was increased by CDCA in a dose-dependent manner with a maximum induction of 15-fold (Fig. 1B). Compared with the result in Fig. 1A, the more robust induction on MDR3 mRNA by
CDCA in Fig. 1B may be because of the variation of individual donors. Northern blot analysis was carried out to confirm the results obtained from the real time PCR. Treatment of the primary human hepatocyte cells with 60 M CDCA or 5 M GW4064 resulted in a 10 20-fold increase of the 4.2-kb RNA band seen with a radiolabeled human MDR3 cDNA probe (Fig. 1C). The Northern blot analysis confirms that endogenous expression of MDR3 is induced by FXR agonists. The MDR3 Promoter Contains an IR-1 That Binds Specifically to the FXR/RXR HeterodimerThe FXR/RXR heterodimer binds to specific DNA sequences in promoters of target genes to regulate gene transcription. The DNA sequences recognized by the heterodimer comprise an inverted repeat separated by a single nucleotide (IR-1). A data base search using the IR-1 consensus sequence identified a highly conserved IR-1 element in the distal promoter of MDR3 (1970 to 1958). To examine whether the FXR/RXR heterodimer binds to this IR-1 element, an electrophoretic mobility shift assay was performed using 32P-labeled IR-1 from the human MDR3 promoter in the presence of in vitro translated human FXR and/or human RXR proteins. The results of EMSAs are shown in Fig. 2A. Neither FXR nor RXR alone bound to the probe (lanes 1 and 2). However, when both FXR and RXR proteins were present, a complex was formed indicating that it is the FXR/RXR heterodimer that is bound by the IR-1 element (lane 3). Competition analysis showed that an unlabeled IR-1 oligonucleotide from MDR3 promoter (Fig. 2B, WT) at a 20-, 50-, or 200-fold molar excess was able to compete for binding in a dose-dependent manner (lanes 4 6), whereas the same molar excess of a mutated oligonucleotide (Fig. 2B, Mut) failed to compete for binding (lanes 79). Moreover, an ideal IR-1 sequence (Fig. 2B, IR-1) efficiently competed for binding at a 20-, 50-, or 200-fold molar excess (lanes 10 12). These results indi-
FIG. 3. Deletion-mutation analysis of the human MDR3 promoter. A, schematic presentation of different MDR3 promoter constructs. The constructs of MDR32201-Luc and MDR32000-Luc contain the IR-1 sequence localized between 1970 and 1958. MDR31955-Luc lacks the IR-1 element, and MDR3mut-Luc contains a mutated IR-1 (mutation in lowercase), which is otherwise the same as MDR32000-Luc. B and C, HepG2 cells (3.cells/well of 96-well plates) were co-transfected with pCMV-lacZ, FXR/RXR expression vectors, and each of the MDR3 promoter constructs as indicated in A. Cells were then treated with 50 M CDCA (B, hatched bars) or 0.5 M GW4064 (C, solid bars) for h, and the cell lysate was used for determination of luciferase and -galactosidase activities as described under Materials and Methods. Luciferase activities were normalized to -galactosidase activities individually for each well. Each value represents the mean S.D. of six determinations. DMSO (open bars), Me2SO.
cate that the IR-1 element in the MDR3 promoter is an authentic FXR/RXR-binding cis element. The IR-1 Element in Human MDR3 Promoter Is Necessary for FXR/RXR-mediated Promoter ActivationTo determine whether the IR-1 element is necessary for FXR/RXR-mediated MDR3 promoter activation, a 2238-bp fragment of the MDR3 promoter (2201 to 37) was cloned upstream of a luciferase reporter gene (Fig. 3A). This construct (MDR32201-Luc) was transiently transfected into HepG2 cells together with FXR and RXR expression vectors, and the transfected cells were treated with 50 M CDCA or 0.5 M GW4064. Luciferase activity was induced by CDCA (Fig. 3B) or GW4064 (Fig. 3C) by 4 6-fold compared with the Me2SO control. To further define the importance of IR-1 element in MDR3 promoter activation, two other reporter constructs, MDR32000Luc and MDR31955-Luc, were also generated (Fig. 3A). MDR32000-Luc is a minimal promoter that contained the IR-1 element, whereas MDR31955-Luc contained a deletion of IR-1 and upstream sequences (Fig. 3A). HepG2 cells were transfected with each of the constructs along with FXR and RXR expression vectors. Luciferase activity was readily induced by 50 M CDCA or 0.5 M GW4064 (5-fold) for the MDR32000-Luc construct, whereas only minimal induction was observed for MDR31955-Luc, which was similar to that of the pGL3 vector control (Fig. 3, B and C). These results indicate that the IR-1 element is necessary for FXR ligand-induced MDR3 promoter activation. Mutation of MDR3 IR-1 Abolishes Promoter Trans-activation by FXR/RXRTo demonstrate further that the IR-1 element at 1970 to 1958 is responsible for the trans-activation of MDR3 promoter, mutations in both halves of the IR-1 element (ATGTCA A TAACCT to AaaTCA A TAAttT; mutated bases in lowercase type) were created in the MDR32000-Luc construct using site-directed mutagenesis, and the mutant construct
(MDR3mut-Luc) was transfected in HepG2 cells together with FXR and RXR expression vectors. Compared with MDR32000Luc, MDR3mut-Luc showed only a modest residual induction by 50 M CDCA (Fig. 3B) and 0.5 M GW4064 (Fig. 3C). This induction was indistinguishable from that of the construct lacking the IR-1 element (MDR31955-Luc) and the pGL3 vector control (Fig. 3, B and C). This result indicates that the integrity of the IR-1 element in the MDR3 promoter is essential for the promoter trans-activation by FXR/RXR. GW4064 Activates the MDR3 Promoter in a Dose-dependent FashionTo determine the dose dependence of MDR3 promoter activation by FXR, the MDR32000-Luc construct (a minimal promoter containing the IR-1 element) was transiently transfected into HepG2 cells together with the FXR and RXR expression vectors, and cells were treated by the synthetic FXR ligand GW4064. Fig. 4 indicates that GW4064 increased the luciferase activity in a dose-dependent manner with an EC50 value of 25 nM and a maximum induction of 8 10-fold. The EC50 value in this assay correlates well with the binding affinity of this ligand on FXR (23). In the absence of exogenous FXR/RXR (without co-transfection with the FXR and RXR expression vectors), GW4064 did not significantly increase the luciferase activity (Fig. 4B). This is presumably because of a low basal level of FXR expression in HepG2 cells that was not enough for activating the MDR3 promoter construct that was transiently transfected into the cells. The FXR and RXR Ligands Additively Activate the MDR3 PromoterIt has been shown previously that several FXR targets are regulated by both bile acids and the RXR ligand, 9-cis-retinoic acid (RA) (21, 23). To determine whether the MDR3 promoter is also regulated by the RXR ligand, the MDR32000-Luc construct was transiently transfected into HepG2 cells together with the FXR and RXR expression vectors. As expected, 9-cis-RA alone efficaciously increased the
FIG. 5. GW4064 and 9-cis-RA additively increase expression of the MDR3 promoter. HepG2 cells (3.cells/well of 96-well plates) were co-transfected with pCMV-lacZ, FXR/RXR expression vectors, and the MDR32000-Luc construct (see Fig 3A). Cells were then treated with various concentrations of 9-cis-RA in the presence (solid bars) or absence (hatched bars) of 50 nM GW4064 for h, and the cell lysate was used for determination of luciferase and -galactosidase activities as described under Materials and Methods. Luciferase activities were normalized to -galactosidase activities individually for each well. Each value represents the mean S.D. of six determinations.
FIG. 4. GW4064 induces expression of the MDR3 promoter in a dose-dependent fashion. A, HepG2 cells (3.cells/well of 96-well plates) were co-transfected with pCMV-lacZ, FXR/RXR expression vectors, and the MDR32000-Luc construct (see Fig. 3A). B, HepG2 cells (3.cells/well of 96-well plates) were co-transfected with MDR32000-Luc construct and pCMV-lacZ. Cells were then treated with various concentrations of GW4064 for h, and the cell lysate was used for determination of luciferase and -galactosidase activities as described under Materials and Methods. Luciferase activities were normalized to -galactosidase activities individually for each well. Each value represents the mean S.D. of six determinations.
luciferase activity in a dose-dependent manner with a maximum induction of 6-fold (Fig. 5). In the presence of 50 nM GW4064, this induction was further increased by 23-fold compared with that induced by 9-cis-RA alone (Fig. 5) indicating that FXR and RXR ligands work additively on the activation of the MDR3 promoter. These results confirm that FXR is a permissive receptor and that it is the FXR/RXR heterodimer that trans-activates the MDR3 promoter.
DISCUSSION
FXR is a bile acid sensor and plays a critical role in expression of hepatic transporters for the uptake and secretion of bile salts, organic anions, and other endo- or xenobiotics. Activated FXR suppresses the expression of Na-dependent taurocholate-co-transporting polypeptide (24), a transporter that is located at the basal membrane for hepatic uptake of bile salts and organic anions. FXR increases transcription of MRP2 (25) and BSEP (15, 16), two transporters that are located at the apical membrane and are responsible for hepatic secretion of bile salts and organic anions. BSEP is critically important for the transport of bile salts across the hepatocyte canalicular membrane (26, 27). Similar to MDR3 deficiencies, BSEP mu-
tations in humans also result in progressive familial intrahepatic cholestasis (3) suggesting that the secretion of both bile acids and phospholipids is critical for normal liver function. Previous studies have shown that FXR/bile acids strongly induce BSEP expression, and this induction is mediated through an IR-1 (a FXR binding site) in the BSEP promoter (15, 16). We therefore hypothesized that FXR/bile acids might also increase expression of the phospholipid transporter MDR3 to coordinate the secretion of bile acids and phospholipids. Treatment of primary human hepatocytes with the endogenous FXR agonist CDCA and the synthetic agonist GW4064 greatly induced MDR3 mRNA (Fig. 1). Consistent with this observation, an IR-1 was identified in the distal promoter of MDR3. Furthermore, deletion or mutation of this IR-1 abolished the binding by the FXR/RXR heterodimer and also abolished MDR3 promoter activation (Figs. 2 and 3) indicating that it is this IR-1 that mediates the up-regulation of MDR3 by FXR. These observations support the idea that bile acids may increase phospholipid secretion via FXR up-regulation of MDR3. Although many of the IR-1 elements of known FXR target genes are located in the proximal promoter, it is not uncommon that the FXRE of human MDR3 promoter is about 2 kb upstream of the transcription start site. It has been shown that the apolipoprotein C-II promoter contains a functional FXRE that is located 7.5 kb upstream of the transcription start site and that this FXRE is essential for FXR-mediated up-regulation of apolipoprotein C-II (28). The discovery of up-regulation of MDR3 by FXR makes good physiological sense. When bile acid concentrations in the liver are elevated, activated FXR on one hand increases expression of BSEP for promoting bile salt secretion and on the other hand up-regulates MDR3 expression resulting in an increased phospholipid secretion. The coordinated regulation of MDR3 and BSEP by FXR represents a feed-forward mechanism for hepatic export of bile acids and phospholipids. The increased expression of BSEP and MDR3 would lead to the efflux of bile acids and phospholipids into bile canaliculi, although both transporters may also influence the secretion of cholesterol into bile resulting in an appropriate ratio of bile acids/phospholipid/ cholesterol. This study provides further evidence for the critical role of FXR in bile acid and cholesterol metabolism.
AcknowledgmentWe thank Dr. Jilly Evans for critically reading the manuscript.
REFERENCES
Moore, D. D. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 14. Claudel, T., Sturm, E., Duez, H., Torra, I. P., Sirvent, A., Kosykh, V., Fruchart, J. C., Dallongeville, J., Hum, D. W., Kuipers, F., and Staels, B. (2002) J. Clin. Investig. 109, 961971 15. Yu, J., Lo, J. L., Huang, L., Zhao, A., Metzger, E., Adams, A., Meinke, P. T., Wright, S. D., and Cui, J. (2002) J. Biol. Chem. 277, 3144131447 16. Ananthanarayanan, M., Balasubramanian, N., Makishima, M., Mangelsdorf, D. J., and Suchy, F. J. (2001) J. Biol. Chem. 276, 2885728865 17. Smit, J. J., Mol, C. A., van Deemter, L., Wagenaar, E., Schinkel, A. H., and Borst, P. (1995) Biochim. Biophys. Acta 1261, 18. Kent, W. J. (2002) Genome Res. 12, 19. Wingender, E., Chen, X., Fricke, E., Geffers, R., Hehl, R., Liebich, I., Krull, M., Matys, V., Michael, H., Ohnhauser, R., Pruss, M., Schacherer, F., Thiele, S., and Urbach, S. (2001) Nucleic Acids Res. 29, 281283 20. Cui, J., Huang, L., Zhao, A., Lew, J. L., Yu, J., Sahoo, S., Meinke, P. T., Royo, I., Pelaez, F., and Wright, S. D. (2003) J. Biol. Chem. 278, 21. Grober, J., Zaghini, I., Fujii, H., Jones, S. A., Kliewer, S. A., Willson, T. M., Ono, T., and Besnard, P. (1999) J. Biol. Chem. 274, 22. Cui, J., Heard, T. S., Yu, J., Lo, J. L., Huang, L., Li, Y., Schaeffer, J. M., and Wright, S. D. (2002) J. Biol. Chem. 277, 2596325969 23. Willson, T. M., Jones, S. A., Moore, J. T., and Kliewer, S. A. (2001) Med. Res. Rev. 21, 513522 24. Denson, L. A., Sturm, E., Echevarria, W., Zimmerman, T. L., Makishima, M., Mangelsdorf, D. J., and Karpen, S. J. (2001) Gastroenterology 121, 25. Kast, H. R., Goodwin, B., Tarr, P. T., Jones, S. A., Anisfeld, A. M., Stoltz, C. M., Tontonoz, P., Kliewer, S., Willson, T. M., and Edwards, P. A. (2002) J. Biol. Chem. 277, 26. Gerloff, T., Stieger, B., Hagenbuch, B., Madon, J., Landmann, L., Roth, J., Hofmann, A. F., and Meier, P. J. (1998) J. Biol. Chem. 273, 27. Green, R. M., Hoda, F., and Ward, K. L. (2000) Gene (Amst.) 241, 117123 28. Kast, H. R., Nguyen, C. M., Sinal, C. J., Jones, S. A., Laffitte, B. A., Reue, K., Gonzalez, F. J., Willson, T. M., and Edwards, P. A. (2001) Mol. Endocrinol. 15, 1720 1728
1. Gottesman, M. M., Hrycyna, C. A., Schoenlein, P. V., Germann, U. A., and Pastan, I. (1995) Annu. Rev. Genet. 29, 2. van Helvoort, A., Smith, A. J., Sprong, H., Fritzsche, I., Schinkel, A. H., Borst, P., and van Meer, G. (1996) Cell 87, 507517 3. Strautnieks, S. S., Bull, L. N., Knisely, A. S., Kocoshis, S. A., Dahl, N., Arnell, H., Sokal, E., Dahan, K., Childs, S., Ling, V., Tanner, M. S., Kagalwalla, A. F., Nemeth, A., Pawlowska, J., Baker, A., Mieli-Vergani, G., Freimer, N. B., Gardiner, R. M., and Thompson, R. J. (1998) Nat. Genet. 20, 233238 4. de Vree, J. M., Jacquemin, E., Sturm, E., Cresteil, D., Bosma, P. J., Aten, J., Deleuze, J. F., Desrochers, M., Burdelski, M., Bernard, O., Oude Elferink, R. P., and Hadchouel, M. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 282287 5. Piekarz, R. L., Cohen, D., and Horwitz, S. B. (1993) J. Biol. Chem. 268, 76137616 6. Gant, T. W., Silverman, J. A., and Thorgeirsson, S. S. (1992) Nucleic Acids Res. 20, 28412846 7. Gant, T. W., Silverman, J. A., Bisgaard, H. C., Burt, R. K., Marino, P. A., and Thorgeirsson, S. S. (1991) Mol. Carcinog. 4, 8. Makishima, M., Okamoto, A. Y., Repa, J. J., Tu, H., Learned, R. M., Luk, A., Hull, M. V., Lustig, K. D., Mangelsdorf, D. J., and Shan, B. (1999) Science 284, 13621365 9. Parks, D. J., Blanchard, S. G., Bledsoe, R. K., Chandra, G., Consler, T. G., Kliewer, S. A., Stimmel, J. B., Willson, T. M., Zavacki, A. M., Moore, D. D., and Lehmann, J. M. (1999) Science 284, 13651368 10. Wang, H., Chen, J., Hollister, K., Sowers, L. C., and Forman, B. M. (1999) Mol. Cell 3, 543553 11. Tu, H., Okamoto, A. Y., and Shan, B. (2000) Trends Cardiovasc. Med. 10, 12. Forman, B. M., Goode, E., Chen, J., Oro, A. E., Bradley, D. J., Perlmann, T., Noonan, D. J., Burka, L. T., McMorris, T., and Lamph, W. W. (1995) Cell 81, 13. Zavacki, A. M., Lehmann, J. M., Seol, W., Willson, T. M., Kliewer, S. A., and
Tags
GY-HD101 Phone Fidelio GV-HIA6 Canvas 11 Temporis Mini TC-WR590 UE37B6000 3245C SPF Thinkpad X21 D-560 Zoom CLP-600 Sedan 11 Aires 200 Bosch 608 KDL20S2500 Dishwasher - TEC VLF7125 Sagem D32T NP2900 12 Gr101 Pulsar 260 C5000 KDC-8090R U205-S5044 Dect4500 ECR 6100 DVP-K360 Technology Matrix 15 5400HS 1100P Plus 400MX PSK75 LAC5800R Oceanus Hilti PR20 D 112 Vanilla RC Nuvi 205 QG3190 00 Virtualdj 4 SGH-X490 ASN-K41C MC-70 Avistar 400 WS2635 RUE-4167 HDC-HS100 Nikkormat FT KX-TGA560 P-334WH GX-700 Stockholm 100 8150 DN 130FG-M DCR-HC46E Analyzer RT-212 NAS-M7HDS GT-E1150I SC-EH570 Fo-a660 FE87E 20U63 Gigaset S44 Hermes KX-TC1040W Review Imageclass D880 NN-J155wbepg BDL4231C F8T061 WA50065 MH18ZC2-09 X3 2005 10000S Nokia 7110 GB 102 WL-5460AP Thalia Sportrak PRO CD245 KX-TG1100HG Iphone SX-PX111 2 D Controller Edition AW1208T Server ASF2484 BM-801 S10 2002 Blade CX2 MPX-808 5460 SG HP1630 SP-310 T3000
manuel d'instructions, Guide de l'utilisateur | Manual de instrucciones, Instrucciones de uso | Bedienungsanleitung, Bedienungsanleitung | Manual de Instruções, guia do usuário | инструкция | návod na použitie, Užívateľská príručka, návod k použití | bruksanvisningen | instrukcja, podręcznik użytkownika | kullanım kılavuzu, Kullanım | kézikönyv, használati útmutató | manuale di istruzioni, istruzioni d'uso | handleiding, gebruikershandleiding
Sitemap
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101








1. DIGI TECH Replacement Battery for Specific Digital Camera and Camcorder Models / Compatible with Kyocera BP 800S, BP 900S, Konica Minolta DR LB1, Yashica BP 1000S, Minolta DR LB1, Sharp AD S30BT, AD S31BT, AD S31BTX, AD T50BT, Kenwood DMC J7R, (Yashica) Finecam S3, S3L, S3x, Kyocera (Yashica) Finecam S5R, Minolta MD MT821, Pioneer PMD R3, PMD R5, Sharp MD MS301, MD MS702, MD MSH(S)2, MD MT66, MD MT821, MD MT831, MD MT832 Includes Mini Tripod with Expandable Legs
2. ENGLISH US ON TRANSPARENT BACKGROUND KEYBOARD STICKERS WITH WHITE LETTERING FOR DESKTOP, LAPTOP AND NOTEBOOK
3. Sharp LC52LE810 52" AQUOS 1080p LED LCD HDTV
4. Sidekick LX 2009 Unlocked Carbon PV300 For Any GSM Carrier (Factory Reconditioned) Danger Slide
