Glycobiology vol. 11 no. 1 pp. 6573, 2001
Human homologs of the Xenopus oocyte cortical granule lectin XL35
Jin-Kyu Lee3, Janet Schnee2, Mabel Pang, Margreet Wolfert3, Linda G. Baum, Kelley W. Moremen3, and Michael Pierce1,3
Department of Pathology and 2Department of Medicine, Division of Cardiology, UCLA Medical School, Los Angeles, CA, USA, and 3Department of Biochemistry and Molecular Biology and Complex Carbohydrate Research Center, University of Georgia, Athens, GA 30602 Received on June 27, 2000; revised on September 8, 2000; accepted on September 12, 2000
The cDNAs encoding two human homologs of the Xenopus oocyte lectin, XL35, were isolated from a small intestine cDNA library and termed HL-1 and HL-2. The deduced amino acid sequence of each homolog is about 60% identical and 80% similar to that of XL35, and none of these sequences contains the C-type lectin motif, although it is known that XL35 requires calcium for ligand binding. By Northern analysis, HL-1 transcripts are present at relatively high levels in heart, small intestine, colon, thymus, ovary, and testis. HL-2 transcripts, by contrast, are expressed only in small intestine. Immunocytochemistry using a polyclonal antibody produced against XL35 shows HL-1 protein to be localized exclusively in endothelial cells in colon, thymus, liver, and other tissues. Primary cultures of human aortic endothelial cells are positive for HL-1 expression by immunoblotting and by PCR analysis, but several other human cell types are not. HL-1 and -2 are both encoded at chromosome 1q23, the same locus that encodes the selectins. XL35, HL-1 and -2, and another mouse homolog are members of a new family of proteins whose members most likely perform diverse functions. Key words: lectin/endothelial cells Introduction Vertebrate lectins perform critically important, diverse functions including cellcell adhesion and pathogen surveillance (Varki, 1999). A specialized function for the lectin found in Xenopus laevis oocyte cortical granules, termed XL35, is to prevent polyspermy. This oligomeric lectin is released extracellularly at fertilization and binds to its polyvalent glycoprotein ligand that is cross-linked in the jelly coat layer surrounding the oocyte (Monk and Hedrick, 1986; Nishihara et al., 1986; Roberson and Barondes, 1982). The ensuing calcium-dependent multivalent interaction participates in the raising of the
fertilization membrane that is impenetrable to sperm (Quill and Hedrick, 1996). The lectin is expressed again at gastrulation and may function as well in cellcell or cellmatrix adhesion events in the embryo (Roberson and Barondes, 1983; Outenreath et al., 1988; Lee et al., 1997). We isolated the cDNA encoding XL35 from a Xenopus oocyte cDNA library (Lee et al., 1997) and determined that the amino acid sequence it encodes did not display the C-type lectin motif, although it does require calcium for binding (Drickamer, 1993). We have recently identified sequence homologs of XL35 and describe here the characterization of two cDNAs, each with an unusual tissue-specific expression pattern, termed HL-1 and HL-2. One of the homologs, HL-1, is expressed exclusively in the vascular endothelial cells in a unique set of tissues, as well as in the endocardium. The other, HL-2, is expressed only in small intestine. These and other results demonstrate the existence of a family of proteins with homology to XL35. Results Isolation of two cDNAs homologous to XL35 from a human small intestine library The XL35 cDNA sequence was analyzed using FASTA and TBLST programs to search for DNA sequence similarity. A single entry was identified from non-Xenopus sources consisting of a 251 bp cDNA sequence from a human heart cDNA library (GenBank accession number Z36760) as an EST (expressed sequence tag) (Figure 1, underline). Using this human EST sequence to design oligonucleotide primers, an amplimer was obtained from human liver, spleen, and placenta cDNA sources that was essentially identical (>98%) to the human heart cDNA sequence in the database. This amplimer was used to probe Northern blots of various human tissue RNAs, and strong signals were detected from a 1.3 kb mRNA in heart and small intestine (data not shown). The amplimer was next used to probe a human small intestine gt 10 cDNA library, and a total of 13 positive plaques showing different sizes between 0.7 and 2.4 kb were isolated. DNA sequencing was performed on seven cDNA clones that had a size greater than 1.0 kb. Sequence data indicated that six clones had the same sequence (named HL-1), but only one clone (HL-2) showed a sequence different from the other 6 clones (Figure 1). These two cDNA sequences showed 85% identity to one another at the deduced amino acid level (Figure 2). A striking result was obtained when the deduced amino acid sequences of the two human homologs were aligned with that of XL35. The overall amino acid identity between HL-1 and XL35 was 60% (similarity, 74%) with a 56% amino acid identity (similarity, 74%) between HL-2 65

whom correspondence should be addressed at: Department of Biochemistry and Molecular Biology, Life Sciences Building, University of Georgia, Athens, GA 30602
2001 Oxford University Press

J.-K. Lee et al.

Fig. 1. Comparison of nucleotide sequences of HL-1 and HL-2. The sequences with solid underline represent the heart EST sequence used as a probe for screening the small intestine cDNA library. The sequences with dashed underline represent the primers used for chromosomal localization, screening of genomic cDNA clones, and Northern analyses. Red, identical nucleotide; blue, conserved nucleotide; black, non-conserved nucleotide.
and XL35. The open reading frame for HL-1 was the same size as that of XL35, 313 amino acids, while HL-2 was predicted to have 325 amino acids. HL-1 and HL-2 have two and one consensus N-linked glycosylation sites, respectively. These sites are conserved with those of XL35, which has a total of three potential sites (Figure 2). Analysis of the N-termini sequence of all three proteins using a signal peptide sequence analysis program (Nielsen et al., 1997) indicated that the Nterminal portion of XL35, HL-1, and HL-2 is composed of hydrophobic amino acids, suggesting the presence of the signal peptide sequence that causes proteins to enter the secretory pathway. XL35 is known to be secreted from the oocytes cortical granules at fertilization (Monk and Hedrick, 1986). A different sequence analysis program, however, predicted that HL-2 would have a single transmembrane domain and short cytoplasmic tail, probably due to the multiple methionine residues at its N-terminus (Hofman and Stoffel, 1993). Genomic DNA screening In order to identify the chromosomal location of the two human homolog sequences, primers were designed to regions 66
Fig. 2. Comparison of deduced amino acid sequences of HL-1, HL-2, and XL35. Sequences with solid underline represent putative signal sequences for secretion. N-Linked oligosaccharide consensus sequences are denoted with an asterisk. Conserved cysteine residues are boxed. Red, identical residue; blue, similar residue; black, unrelated residue.
Human homologs of Xenopus oocyte lectin
of the HL-1 and HL-2 cDNAs whose nucleotide sequences were distinct from each other (9/25 and 19/25 mismatches, respectively, dashed and underlined sequences in Figure 1). These primers produced clear, unique 161 bp PCR products with each cDNA sequence upon amplification with human genomic DNA. These primer pairs were then used for genomic DNA screening and also used directly for chromosomal mapping. Two genomic clones containing HL-1 and HL-2 were isolated by Genomic Systems, Inc. A comparison of the partial DNA sequences of these genomic clones indicated that the HL-1 and HL-2 genes have at least one intron that differs in size and location (work in progress). Moreover, PCR reactions from several combinations of synthetic primers and each genomic clone revealed products of different size. These results demonstrate that HL-1 and HL-2 cDNA clones are different gene products. Chromosomal localization To analyze the chromosomal localization of the HL-1 and HL-2 genes, FISH (fluorescence in situ hybridization) analysis was performed using genomic clones encoding HL-1 and HL-2 isolated by Genomic Systems, Inc. Both clones hybridized to chromosome 1q band 23 (data not shown). Recently, fragments of genomic sequence in the human genome database confirmed our results that localized both HL-1 and -2 at chromosome 1q 2223.5. One cosmid clone of 190 kb contained both HL-1 and -2 sequences. This result suggests that the two sequences arose most likely from a gene duplication event that ultimately resulted in proteins with similar sequences, but with tissue-specific promoters. Intriguingly, the genes that encode the selectin family of lectins are found between 1q22 and 1q25 (Watson et al., 1990). Tissue distribution of HL-1 and HL-2 mRNA The tissue transcript levels of HL-1 and HL-2 were determined by Northern blot analysis using the 161 bp radiolabeled probe described above. The major transcripts of both HL-1 and HL-2 were 1.3 kb in length (Figure 3A,B). The transcript of HL-1 was observed in relatively very high levels in heart, colon, small intestine, and thymus, with lower levels in ovary, testis, and spleen (Figure 3B). Additional Northern analyses also showed strong signals in lymph node and stomach (data not shown). By stark contrast to HL-1, the transcript of HL-2 was detectable exclusively in small intestine (Figure 3A). The size of this transcript was 1.3 kb, similar to that of HL-1. HL-2 is most likely more abundant than HL-1 in small intestine, since 6 of 7 clones isolated from the small intestine cDNA library contained HL-2 cDNA sequences. In an earlier experiment using nucleotide primers that did not distinguish between the two transcripts, PCR analysis also detected transcripts in human liver mRNA, although this tissue was negative by Northern analysis (Figure 3A). Subcloning and sequencing confirmed that the PCR product corresponded to an HL sequence. This result suggests that transcripts for HL-1 and -2 may be present in tissues that are negative for expression by Northern analysis; for example, if the cell type expressing them constitutes a very minor fraction of cells in a particular tissue.

Fig. 3. Tissue distribution of HL-1 and HL-2 mRNA transcripts. A Northern blot of human tissue poly(A) RNAs was hybridized with radiolabeled specific probes (Figure 1) for HL-2 (A) or HL-1 (B), as described in Materials and methods. Hybridized signals were detected by exposure to x-ray film, which was photographed using transillumination.
Cell type specific expression of HL-1 To determine which cell types expressed HL-1, immunohistochemistry was performed on human tissue sections using rabbit polyclonal antisera prepared against affinity-purified XL35. Striking results were obtained from colon, liver and thymus sections using anti-XL35 primary antisera and peroxidaseconjugated secondary antibody. The antisera specifically and intensively stained endothelial cells lining the blood vessels in these tissues (Figure 4), while pre-immune serum staining was negative. In all tissues, the labeling appeared throughout the endothelial cells, not just adsorbed to the cell surface. In the colon, endothelial cells lining vessels in both the submucosa (arrows) and the lamina propria (arrowheads) were stained with high intensity (Figure 4B,C), consistent with the high level of transcripts observed by Northern analysis (Figure 3A). Staining of liver revealed intense immunoreactivity in both the small hepatic arteries and hepatic veins in the portal tract 67
(Figure 4E, arrows), as well as weaker reactivity of endothelial cells lining the hepatic sunusoids (Figure 4E, arrowhead). In thymus, prominent staining of vessels was noted (Figure 4G). An identical pattern of staining was noted in tonsil, a specialized lymph node, including high endothelial venule cells (data not shown). In heart sections, the endocardium, derived from endothelium, and heart blood vessel endothelial cells showed immunoreactivity, with weak interstitial staining of myocardium (data not shown). These results show that the HL-1 protein is expressed in the endothelial cells in specific tissues, consistent with the tissue specific mRNA expression pattern we observed. HL-1 expression is restricted to endothelial cells Primary cultures of human aortic endothelial cells were extracted, separated by reducing SDSPAGE, and examined by Western blotting using anti-XL35 polyclonal antibody. As shown in Figure 5, human aortic endothelial cells (HE) contained a dominant species of 42 kDa. An identical band was observed in human aortic endothelial cells that had been pretreated with the endothelial cell activating agent, LPS (HE/L). Fully glycosylated XL35 migrates as a broad band of 4245
kDA on reducing SDS-gels, while N-glycanase-treated XL35 migrates as a sharp band at 35 kDa (Lee et al., 1997). Thus, these data indicate that human aortic endothelial cells express a protein similar to the apparent molecular weight of glycosylated XL35 and to the predicted molecular weight of N-glycosylated HL-1. Similar results were observed using a polyclonal antisera prepared against a synthetic peptide whose sequence is found in HL-1, showing that the XL35 protein is being recognized by the antisera (data not shown). Moreover, expression of this protein was apparently unaltered in cultured cells by the addition of an endothelial cell activating agent, suggesting that the tissue specific expression pattern we observed by both Northern analysis and immunohistochemistry did not likely relate to the activation state of the endothelia in those particular tissues. No immunoreactivity was seen in primary tissue cultures of epithelial cells from thymal stroma (TS), a tissue in which HL-1 is expressed, indicating that expression of HL-1 is restricted to endothelial cells. The identity of the band observed at 85 kDa (Figure 5) is unknown at this time, although purified XL35 can show higher molecular weight

Fig. 4. Expression of XL35 related protein in human endothelial cells in a variety of tissues. (A) Colon, preimmune serum; (B, C) colon, XL35 antiserum. Immunoreactive material (intense reddish-brown stain) is visible in small vessels in colon in both submucosa (arrows) and lamina propria (arrowheads), but is not seen in control sample. (D) Liver, preimmune serum; (E) liver, XL35 antiserum. Immunoreactive material is visible in small vessels in both the portal tract (arrows) and the hepatic sinusoids (arrowheads). (F) Thymus, preimmune serum; (G) thymus, X35 antiserum. Immunoreactive material is present throughout cells lining small vessel (arrow).
species when samples are not completely reduced prior to or during electrophoresis. To confirm this restricted expression of HL-1, we performed RT-PCR analysis of mRNA from cultured cells arising from several tissue types. As shown in Figure 6, a specific band was amplified only from human aortic endothelial cells. No band was amplified from Hep G2 cells (hepatic epithelial cell carcinoma), T cells, thymic epithelial cells, or bone marrow stromal cells. As a control, NIH 3T3 cells transfected with cDNA encoding HL-1 were also analyzed. The amplified band was detected only in the transfected 3T3 cells (3T3tx), but not in the mock transfected cells (3T3), again demonstrating the specificity of the amplified band. In summary, results from several experimental approaches document the discovery of human homologs of the Xenopus oocyte cortical granule lectin, termed HL-1 and HL-2. The deduced amino acid sequences of these proteins are over 60% identical and 74% similar to that of XL35, and show long stretches of identical sequences, HL-1 is localized exclusively in vascular endothelial cells present in a unique set of tissues, while HL-2 appears to be expressed only in small intestine. Discussion The Xenopus oocyte cortical granule lectin XL35 is a soluble protein that makes up about 70% of the protein found in the cortical granules (Nishihara et al., 1986). The lectin has an
Fig. 6. Expression of HL-1 is restricted to human endothelial cells. PCR analysis of cDNA from cultured cells demonstrated a strong signal from both untreated (HE) and LPS-treated HAECs (HE/L) of the expected size of 482 bp (arrow). No PCR product was detectable in samples from Hep G2 cells, human T cells, human bone marrow stroma (BMS) or human thymic epithelium (TE). As a positive control, HL-1 was expressed in NIH 3T3 cells (3T3 tx). The lower band seen in all lanes represents free primers.

Fig. 5. Detection of immunoreactive material in human aortic endothelial cells. Extracts of human thymic stroma (TS) or human aortic endothelial cells (HE), treated with or without LPS (HE/L), were subjected to immunoblot analysis using antiserum to XL35 after SDSPAGE under reducing conditions.
oligomeric structure with an apparent molecular weight of 500 kDa under non-reducing conditions (Roberson and Barondes, 1982; Chamow and Hedrick, 1986). Reducing SDSPAGE reveals a monomer of about 45 kDa with size heterogeneity due to N-linked oligosaccharides (Lee et al., 1997). At fertilization, the contents of the granules are secreted from the oocyte, and the multimeric lectin binds to its oligosaccharide ligands found in the surrounding egg jelly. These ligands are expressed on 500 kDa mucin-like glycoproteins cross-linked by disulfide bonds, each containing hundreds of O-linked saccharides (Quill and Hedrick, 1996). The result of this binding reaction is an aggregation of lectins and large molecular weight glycoprotein ligands that participates in the formation of the fertilization membrane and block to polyspermy. XL35 mRNA and protein are also found in the zygote and the message levels show a large increase during gastrulation, implying that the lectin is expressed and functions during morphogenesis. Relatively low levels of the message are found in the tadpole stage (Lee et al., 1997). It was quite interesting, therefore, to find homologs of XL35 in adult human tissues. The amino acid sequences of the lectins predict signal sequences for secretion, and XL35 is known to be secreted at fertilization. If the putative signal sequences, which are very divergent, are excluded from consideration, the identity between the HL-1 and XL35 amino acid sequences is 63% and the similarity is 75%. Moreover, eight conserved cysteine residues are observed between the two sequences. HL-2 shows slightly less identity and similarity to XL35 than does HL-1. Although we have no direct evidence as yet, these 69
structural considerations suggest HL-1 and HL-2 may indeed function as lectins. The oligosaccharide binding specificity of XL35 is known in general terms; however, the location of the amino acids that constitute its binding site is as yet unknown. Western blots of partly purified rat heart homogenate using polyclonal antisera against XL35 identify several protein bands with molecular weights roughly similar to those of HL-1 in human heart aortic endothelial cells (Figure 5). To determine if the homolog in rat heart has a ligand binding specificity similar to that of XL35, the rat heart extract was applied in the presence of Ca2+ to an affinity column of immobilized melibiose, an -linked disaccharide to which XL35 binds (Roberson and Barondes, 1982). Bound proteins were eluted with EDTA, and the eluted proteins were analyzed by Western blotting using anti-XL35 antisera (Lee, 1997). No lectin-related proteins bound to the melibiose column, showing that the rat heart homolog most likely does not bind the same disaccharide as does XL35. Since only very minor differences in the amino acid sequence of lectins can yield proteins that differ in their binding specificity, no prediction can be made whether HL-1 and HL-2 bind the same ligand (Drickamer, 1992). No C-type lectin motif is found in XL35 (Drickamer, 1993), although it has calcium-dependent oligosaccharide ligand binding activity. Likewise, HL-1 and -2 sequences do not contain this motif. A small region of XL35 and the human homologs, however, does contain a fibrinogen-like motif, Figure 7. Members of the Ficolin/Opsonin/p35 lectin family contain significant homology to fibrinogen, in addition to collagen-like domains (Kilpatrick et al., 1997; Ohashi and Erickson, 1997). Proteins in this family are found in serum, some have been shown to have lectin-like activity, and they have been postulated to function generally in pathogen opsinization (Matsushita et al., 1996). It has been hypothesized that the carbohydrate-binding domain present in this family of lectins is contained at least partially in the small domains they share with fibrinogen. As depicted in Figure 7, HL-1, HL-2, and XL35 all contain a portion of a fibrinogen-like motif found in the Ficolin/Opsonin/p35 family, suggesting that this region may encode their carbohydrate binding domains. Both ficolin and the Hakata antigen, a circulating serum lectin that is a member of the Ficolin/Opsonin/ p35 family (Sugimoto et al., 1998), however, also contain this small fibrinogen-like motif shared with HL-1, HL-2, and XL35. Neither of these proteins, however, require calcium for their carbohydrate binding activity. It is unlikely, therefore, that this domain found in XL35 is predominantly responsible for its ligand binding activity, but further experiments are obviously necessary to identify its oligosaccharide binding site and the putative binding sites in HL-1 and -2.

A brief report described a mouse cDNA sequence isolated by differential hybridization techniques that hybridizes with specialized cells in the mouse small intestine (Komiya et al., 1998), although the degree of cell specificity of expression was not clear from the data presented. The deduced amino acid sequence from this cDNA shows a 60% homology with the XL35 sequence, and because of this homology, the sequence was named intelectin. Comparing human HL-1 and HL-2 deduced amino acid sequences to that of the murine intelectin shows about a 50% homology of the murine molecule to either human sequence. The presence of HL-1 in vascular endothelial cells, coupled with the detection of the HL-2 transcript in small intestine and a transcript similar to the human lectins in mouse small intestine, demonstrates defined, unique expression patterns for these homologs. Members of this family with sequences similar to the Xenopus cortical granule lectin clearly must have functions distinct from that of the cortical granule lectin. Experiments to define these functions are in progress.
Materials and methods Materials Nitrocellulose filters, DNA labeling kits, [-32P] dCTP, [35S]methionine, and Amplify reagent were purchased from Amersham. Ready polyacrylamide gels and Zeta-Probe GT nylon membranes for Southern analysis were purchased from Bio-Rad (Hercules, CA). N-Glycanase, protease inhibitor cocktail tablets, and PCR reaction master mix were from Boehringer Mannheim (Indianapolis, IN). BSA, IPTG, melibiose, and immobilized melibiose were from Sigma (St. Louis, MO). Sephaglas DNA purification reagent was from Pharmacia (Uppsala, Sweden). Ni++-NTA columns and pQE vectors were from Qiagen (Chatsworth, CA) and were used according to the manufacturers instructions. The pCR II cloning vector was from Invitrogen (San Diego, CA). Restriction enzymes, Thermus aquaticus DNA polymerase, agarose, and other chemicals were purchased from major chemical suppliers. Oligonucleotides were synthesized by the University of Georgia Molecular Genetics Instrumentation Facility. The BCA protein assay kit was from Pierce (Rockford, IL). Fetal calf serum was obtained from Upstate Biotechnology Inc (Lake Placid, NY). The human small intestine 5-stretch cDNA library, gt10 cDNA insert screening amplimer set, and human multiple tissue Northern blots were obtained from Clontech (Palo Alto, CA). Human liver, thymus, colon, tonsil, and heart were obtained from the UCLA Department of Pathology Human Tissue Research Center. Primary cultures of human
Fig. 7. Conserved sequences between HL-1, HL-2, and XL35 and members of the Ficolin/Opsonin/p35 lectin family. Conserved cysteine residues are boxed. Red, identical residue; blue, similar residue; black, unrelated residue.

aortic endothelial cells (HAEC) were the gift of Dr. Judith Berliner (UCLA, Los Angeles, CA). NIH 3T3 and Hep G2 cells were obtained from ATCC (Rockville, MD). Human peripheral blood T cells and thymic epithelial cells were obtained as described previously (Perillo et al., 1995). Human bone marrow stroma was the kind gift of Dr. Bruce Torbett (Scripps Clinic and Research Foundation, La Jolla, CA). Detection of partial cDNA sequences of human homologs XL-35 cDNA and peptide sequences were used to search protein and DNA sequence databases, and a single entry was identified from non-Xenopus sources. The sole sequence match was a fragmentary 251 bp cDNA sequence obtained from a human heart cDNA library (GenBank, Accession number Z36760) as an expressed sequence tag (EST) (Figure 1). Using the human EST sequence, we designed oligonucleotide primers (sense primer: 5-CAGACCTTCTGTGACATGACCTCT-3 and antisense primer: 5-AAGATGCCCAGGTCCTTGGCCTGG-3). The human placenta, spleen, and liver cDNAs were subjected directly to PCR reactions in a 25 l reaction volume containing 1 M of each primers, 10 ng of each cDNA, 0.2 mM of each dNTP, 10 mM TrisHCl, 50 mM KCl, 1.5 mM MgCl2, and 1.5 units of Taq polymerase. The thermal cycling conditions were 92C, 1 min; 55C, 1 min; and 72C, 1 min, for a total of 35 cycles. The amplification products were separated on a 0.7% agarose gel and purified using Sephaglas DNA purification kit (Pharmacia). Each amplimer was subcloned into the pCR II vector using the TA cloning kit (Invitrogen) and fully sequenced. The deduced peptide sequences from the PCR products, the human heart EST sequences, and the XL-35 cDNA clone were aligned to compare their sequence identities. The cDNA amplimers from the human tissues were essentially identical to the human heart EST sequence. cDNA library screening A human small intestine 5-stretch gt10 cDNA library was purchased from Clontech and was screened by plaque hybridization using the 251 bp amplification product of the human liver cDNA as a radiolabeled probe. The cDNA amplimer was isolated on a 1% agarose gel, purified, and labeled using [-32P]-dCTP and the Mega-Prime labeling kit (Amersham). Plaque lifts were screened by standard formamide/SSC hybridization conditions using Hybond-N filters (Amersham) (Sambrook et al., 1989). Positive phage clones identified by plaque hybridization were purified through four rounds of plaque purification. Lambda DNA from positive clones was isolated from 100 ml cultures by polyethylene glycol precipitation followed by chromatography over a Qiagen Tip-100 column as described by the manufacturer (Qiagen). The full-length inserts from the clones were isolated by PCR amplification using primers specific for the flanking vector sequences. A total of 13 clones were identified with insert sizes varying from 0.7 to 2.4 kb. Seven cDNA inserts >1.2 kb were subcloned into the pCR II vector and fully sequenced. Comparison of the sequences of the clones indicated that six of the clones were identical (named HL-2) and one clone (HL-1) had a different sequence (Figure 1).

DNA sequence analysis All cDNA clones and genomic clones were sequenced by using Taq polymerase in the dideoxy dye-terminator reaction using T7 or SP6 polymerase primers, or synthetic primers. The sequencing reactions were analyzed on an Applied Biosystem 373A DNA sequencer (Molecular Genetics Instrumentation Facility, University of Georgia). DNA sequence data were assembled into a contiguous sequence database by the method of Staden (1987)). A sequence similarity search between protein or DNA sequences was performed using the Bestfit, Pileup, Fasta, and Tblast programs of the University of Wisconsin Genetics Computer Group (GCG software, version 8.0). Isolation of genomic DNA clones An arrayed human genomic library in the P1 vector (Genome Systems, Inc., St Louis, MO) was screened by a PCR approach (Pierce et al., 1992; Shepherd et al., 1994) using primer pairs specific for the respective genes. Pools of clones were screened by PCR amplification using primers for HL-1 (sense primer: 5-ATACTTTCCAGAGGCCAGTCCCCAG-3, antisense primer: 5-AGGTCTGGGTTCCCTCCCACAAAAC-3) or HL-2 (sense primer: 5-GTTCTTCCCACAGGGCAAACCCCGT-3, antisense primer: 5-TCTGCCCTGACACCGGAGAGCTCTG3). The PCR reactions were performed in a 25 l reaction volume containing 1 M of each primers, 50 ng of human genomic DNA, 0.2 mM each dNTP, 10 mM TrisHCl, 50 mM KCl, 1.5 mM MgCl2, and 1.5 units of Taq polymerase. The thermal cycling conditions were: 94C, 1 min; 65C, 1 min; and 72C, 1 min, for a total of 35 cycles. An amplimer of 160 bp was obtained from PCR reactions from the respective template (dotted-line sequences in (Figure 1). The sequence of each amplimer was identical to that of each cDNA clone, which implied that the region of amplification in the lectin genes did not contain introns. The same primers and PCR reaction conditions were used for the screening of genomic DNA clones. Two genomic clones were isolated for both HL-1 and HL-2 and each was partially sequenced using synthetic primers designed based in the sequence of the cDNA clones. Sequence data and results of PCR amplification indicated that each clone contained either HL-1 or HL-2, but not both genes. Northern blot analysis The cDNA-specific PCR products for HL-1 or HL-2 obtained from PCR of human liver cDNA were labeled using [-32P] dCTP and the Mega-Prime labeling kit (Amersham) according to the manufacturers instructions. The 161 bp amplimers probes for HL-1 and HL-2 obtained from PCR were only 63.9% identical in sequence (58/161 mismatches). The radiolabeled cDNA fragments were used to probe Northern blots of various human tissue poly(A+) RNAs (human multiple tissue Northern blot, Clonetech). The blots were probed using a prehybridization buffer consisting of 0.5 M Na phosphate, pH 7.0, 1 mM EDTA, 7% SDS, 10 mg/ml of fatty acid free BSA, and 100 g/ml denatured herring sperm DNA. The hybridization was using the identical buffer, except for the addition of denatured radiolabeled probe. Prehybridization was performed for 2 h at 65C, and hybridization was performed overnight at 65C. The blots were washed three times at 65C for 15 min in 50 ml of 40 mM Na phosphate, pH 7.0, 1% SDS, 71

1 mM EDTA, and 0.5% fraction V BSA and an additional three times at 65C for 15 min in the same buffer excluding BSA. The blots were then washed in 50 ml of 1 M phosphate buffer, pH 7.0, at room temperature for 10 min and data collected using a Molecular Dynamics phosphoimager or autoradiography. Immunoblot analysis Polyclonal rabbit antisera against affinity-purified XL35 was prepared similarly to that described by Barondess laboratory (Roberson and Barondes, 1983). Antisera was specific for XL35 on Western blots of oocytes, and reacted with N-glycanasetreated XL35. Human thymic stroma, obtained after removal of thymocytes, was extracted by homogenization in lysis buffer (10 mM Tris, pH 7.3, 130 mM NaCl, 5 mM CaCl2, 1 mM PMSF, 0.5% NP-40). Cultured human aortic endothelial cells (HAEC), either stimulated with LPS (Baum et al., 1995b) or mock stimulated controls, were lysed by brief vortexing in lysis buffer. Nuclei were removed by centrifugation for 2 min at top speed in a microcentrifuge. Two hundred micrograms of protein were loaded per lane, and electrophoresed under reducing conditions. Immunoblot analysis was performed as described previously (Baum et al., 1995b). The blot was probed with rabbit polyclonal antiserum against native XL35 diluted 1:1000 in 100 mM Tris, 150 mM NaCl, 0.1% Tween (TBST) with 1% nonfat dry milk. After repeated washes with TBST, the blot was incubated with horseradish peroxidase conjugated goat anti-rabbit IgG (Bio-Rad), and visualized by chemiluminescence (ECL, Amersham). RT-PCR analysis Total RNA was purified from the indicated cell types using Trizol reagent (Gibco BRL), according to the manufacturers directions. Two micrograms of total RNA was reverse transcribed (Ready to go T primed first strand kit, Pharmacia). Two microliters of the first strand reaction was used as template for PCR amplification. PCR was performed using 200 M dNTP, 1 M each oligonucleotide primer, and Taq polymerase and buffer (Stratagene). The sequence of the 5 primer was 5CAGACTACCCAGAGGGGGACGGCAACTGG3. The sequence of the 3 primer was 5CTCCACCAATGCAGTGGTGCTCAGTGTTAC3. The thermal cycling conditions were: 94C 45 s, followed by 72C 2 min for a total of 40 cycles followed by a final extension for 10 min at 72C. Immunohistochemical analysis Experiments were performed on 6 mm sections of the indicated tissues as previously described (Baum et al., 1995a), using rabbit polyclonal antiserum against native XL35 diluted 1:1000, and the sections were counter-stained with hemotoxylin. Control sections were incubated with a similar dilution of preimmune serum. Acknowledgments We wish to acknowledge support from the American Heart Association and NIHGMS. J. S. was a trainee of the UCLA STAR Program. 72

Abbreviations XL35, Xenopus laevis cortical granule lectin; LPS, lipopolysaccharide; HL-1 and HL-2, human lectins 1 and 2; HE, human aortic endothelial cells; HE/L, human aortic endothelial cells treated with lipopolysaccharide; TE, thymic epithelia; BMS, human bone marrow stroma; TE, human thymic epithelium; HAEC, human aortic endothelial cells. References
Baum, L.G., Pang, M., Perillo, N.L., Wu, T., Delegeane, A., Uittenbogaart, C. H., Fukuda, M., and Seilhamer, J.J. (1995a) Human thymic epithelial cells express an endogenous lectin, galectin-1, which binds to core 2 O-glycans on thymocytes and T lymphoblastoid cells. J. Exp. Med., 181, 877887. Baum, L.G., Seilhamer, J.J., Pang, M., Levine, W.B., Beynon, D., and Berliner, J.A. (1995b) Synthesis of an endogenous lectin, galectin-1, by human endothelial cells: increased synthesis in activated endothelial cells. Glycoconjugate J., 12, 6368. Chamow, S.M. and Hedrick, J.L. (1986) Subumit structure of a cortical granule lectin Involved in the block to polyspermy in Xenopus laevis eggs. FEBS Lett., 206, 353357. Drickamer, K. (1992) Engineering galactose-binding activity into a C-type mannose-binding protein. Nature, 360, 183186. Drickamer, K. (1993) Ca2+-dependent carbohydrate-recognition domains in animal proteins. Curr. Opin. Struct. Biol., 3, 393400. Hofman, K. and Stoffel, W. (1993) TMbase-A database of membrane spanning protein segments. Biol. Chem. Hoppe-Seyler, 347, 166168. Kilpatrick, D.C., Fujita, T., and Matsushita, M. (1997) P35, an opsonic lectin of the ficolin family, in human blood from neonates, normal adults and recurrent miscarriage patients. Immunol. Lett. 67, 109112. Komiya, T., Tanigawa, Y., and Hirohashi, S. (1998) Cloning of the novel gene intelectin, which is expressed in intestinal paneth cells in mice. Biochem. Biophys. Res. Commun., 251, 759762. Lee, J.-K. (1997) Discovery of a new superfamily of animal lectins. In Biochemistry and Molecular Biology. University of Georgia, Athens, GA. Lee, J.-K., Buckhaults, P., Wilkes, C., Teilhet, M., King, M.L., Moremen, K.W., and Pierce, M. (1997) Cloning and expression of a Xenopus laevis oocyte lectin and characterization of its mRNA levels during early development. Glycobiology, 7, 367372. Matsushita, M., Endo, Y., Taira, S., Sato, Y., Fujita, T., Ichikawa, N., Nakata, M., and Mizuochi, T. (1996) A novel human serum lectin with collagen- and fibrinogen-like domains that functions as an opsonin. J. Biol. Chem., 271, 24482454. Monk, B.C. and Hedrick, J.L. (1986) The cortical reaction in Xenopus laevis eggs: cortical granule lectin release as determined by radioimmunoassay. Zool. Sci., 3, 459466. Nielsen, H., Engelbrecht, J., Brunak, S., and Heije, G.V. (1997) Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng., 10, 16. Nishihara, T., Wyrick, R.E., Working, P.K., Chen, Y.-H., and Hedrick, J.L. (1986) Isolation and characterization of a lectin from the cortical granules of Xenopus laevis eggs. Biochemistry, 25, 60136020. Ohashi, T. and Erickson, H.P. (1997) Two oligomeric forms of plasma ficolin have differential lectin activity. J. Biol. Chem., 272, 1422014226. Outenreath, R.L., Roberson, M.M., and Barondes, S.H. (1988) Endogenous lectin secretion into the extracellular matrix of early embryos of Xenopus laevis. Dev. Biol., 125, 187194. Perillo, N.L., Pace, K.E., Silhamer, J.J., and Baum, L.G. (1995) Apoptosis of T cells mediated by galectin-1. Nature, 278, 736739. Pierce, J., Sternberg, N., and Sauer, B. (1992) A mouse genomic library in the bacteriophage P1 cloning system: organization and characterization. Mamm. Genome, 3, 550558. Quill, T.A. and Hedrick, J.L. (1996) The fertilization layer mediated block to polyspermy in Xenopus laevis: isolation of the cortical granule lectin ligand. Arch. Biochem. Biophys., 333, 326332. Roberson, M.M. and Barondes, S.H. (1982) Lectin from embryos and oocytes of Xenopus laevis: purification and properties. J. Biol. Chem., 257, 75207526. Roberson, M.M. and Barondes, S.H. (1983) Xenopus laevis lectin is localized at several sites in Xenopus oocytes, eggs and embryos. J. Cell Biol., 97, 18751881.

Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecular Cloning, a Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Shepherd, N.S., Pfrogner, B.D., Coulby, J.N., Ackerman, S.L., Vaidyanathan, G., Sauer, R.H., Balkenhol, T.C., and Sternberg, N. (1994) Preparation and screening of an arrayed human genomic library generated with the P1 cloning system. Proc. Natl. Acad. Sci. USA, 91, 26292633. Staden, R. (1987) Computer handling of DNA sequencing projects. In Bishop, M.J. and Rawlings, C.J. (eds.), Nucleic Acid and Protein Sequence Analysis, a Practical Approach. IRL Press, Oxford, pp. 173217. Sugimoto, R., Yae, Y., Akaiwa, M., Kitajima, S., Shibata, Y., Sato, H., Hirata, J., Okochi, K., Izuhara, K., and Hamasaki, N. (1998) Cloning and
characterization of the Hakata antigen, a member of the ficolin/opsonin p35 lectin family. J. Biol. Chem., 273, 2072120727. Varki, A. (1999) Discovery and classification of animal lectins. In Varki, A., Cummings, R., Esko, J., Freeze, H., Hart, G., and Marth, J. (eds.), Glycobiology. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 333343. Watson, M.L., Kingsmore, S.F., Johnston, G.I., Siegelman, M.H., Le Beau, M.M., Lemons, R.S., Bora, N.S., Howard, T.A., Weissman, I.L., and McEver, R.P. (1990) Genomic organization of the selectin family of leukocyte adhesion molecules on human and mouse chromosome 1. J Exp. Med., 172, 263272.

INDEX TO VOLS. XXX1.-XXXIX.
the Plica Vascularis, leading to Appendicitis, xxxii. 64-66. Rolleston, Dr H. D., and Fenton, W. J., Two Anomalous Forms of Duodenal Pouches, xxxv. 110-113. Rollet, Prof. A., Summary of a Paper entitled-" On the Variations in the Character of the Contractions of Striated Muscle with the Periodic Stimulation of some Duration, and on Recovery of the Muscle," xxxi. 306-308. Romanovsky and Winiwarter on Ectopia of Testis, xl. 300. Romiti on the Processus Marginalis (mentioned), xxxiii. 500. Rond on an Anomaly of the Duodenum and Transverse Colon (mentioned), xxxiii. 504, 683. Rontgen-ray Photographs of Wrist (Bryce), xxxxi. 59-79; Stereoscopy Bone Architecture illustrating (Haughton and Dixon), xxxvii. p. lxi. Rook, Absence of Hiemolymph Glands in, xxxviii. 317, 318; Elastic Fibres in the Eye of, xl. 21. Rosanow on Abnormalities connected with the Breast, xxxix. 505. Rose, J., on the 'Native Tribes of Eastern Equatorial Africa, xxxvi. 93. Rosenberg on a Primitive Form of Vertebral Column in Man (mentioned), xxxiii. 679. Rosenfeld on the Comparative Anatomy of the Tibialis Posticus (mentioned), xxxiii. 501 ; on the Shoulder Ligaments of Men and some Mammals (mentioned), xxxiii. 501. Rosenhaupt on Abdomino-pelvic Fissure, xl. 299. Rosenmuller, Organ of, xxxvi. 152. Rosenthal on Diaphragmatic Hernia, xxxiii. 520. Rough Dab, xxxiv. 4, 34. Rousseau, the Innervation of the Palatine Vault (mentioned), xxxiii. 685. Roy, Dr P., and Launois, Prof. P. E., Btudes sur les Geants (Notice), xxxix. 369; on Giants, xl. 292. Rudd, xxxiv. 4, 28, 30.
Rudimentary Clavicles and other Abnormalities of the Skeleton of a White Woman (Terry), xxxiii. 413422 ; First Thoracic Rib in a Horse (Bradley), xxxvi. 54-62; Forearm and Hand (Savage), xxxv. p. xix; Penis, xxxii. 792. Ruffini, A., on a Bony Projection from the Mastoid Process, xxxiv. 417. Rufus Rat Kangaroo, Popliteus Muscle in, xl. 35. Ruggeri, G., the Weight of the Brain in relation to Cranial Form and Metopism (mentioned), xxxiii. 685. Ruminants, Abnormality in Dentition of, xxxvii. 306; Coronal Suture in, xl. 242; Polydactyly in, xxxix. 508 Teeth of, xxxvi. 366. Russell, B. R. G., Antiquities of Orkney, xxxvi. 422. F., Studies in Cranial Variation (Notice), xxxv. 275. Rutherford, Prof., on the Structure of Striped Muscular Fibre, xxxi. 309342. W. J., Notes on a Case of Feather-bifurcation, xxxvii. 368374. Rutherford's Microtome, a Modification of (Harris), xxxiii. 609-611.
S. romanum, xxxiii. 442. Saalfeld on the Glandulse Tysoni (mentioned), xxxiii. 505. Sabin, Florence R., on the Anatomical Relation of the Nuclei of Reception of the Cochlear and Vestibular Nerves (mentioned), xxxiii. 506. Sacral Curve in Australian, xxxvii. 91; Index in Australian, xxxvii. 91. Sacro-genital Folds, xxxiv. 192; xxxvi. 132, 135, 136, 140. Saillant and Maygrier, Contracted Large Intestine, xxxviii. 368. St Blaise on Atresia of the Alimentary Canal, xxxiii. 520. Salaman, Dr R. N., Volvulus of Small Bowel, xxxvii. p. ii. Salamander, Renal Portal System of, xxxvi. 40, 43; Spleen of, xxxv. 425. Salamandra, xxxvii. 131 ; atra, Renal Portal Veins of, xxxvi. 40; perspi-
INDEX TO VOLS. XXXI.-XXXIX.
cillate, Experiments on Ova of, xxxii. 782. Salivary Digestion of Starch in Simple and Mixed Diets (Robertson), xxxii. 615-651; Gland, Parotid, Absence of, xxxvi. 421; Glands, xxxv. 34; Chondromata of, xl. 299; of Macropus and Petrogale, xxxii. 131. Salmo, Superior Commissure in, xxxviii. 280; fario, xxxii. 506 ;ferox, xxxiv. 4; fontinalis, xxxii. 506; lacustris, xxxi. 456 ; quinnat, xxxii. 506 ; salar, xxxii. 506 ; xxxiv. 4 ; Anatomy of the Digestive Tract in (Barton), xxxiv. 295-300; the Digestive Tract in Kelts (Barton), xxxvi. 142-146; trutta, xxxii. 507. Salmon and Anthony on Pygomelia, xxxvii. 303; xl. 297. Salmon, Anatomy of the Digestive Tract in (Barton), xxxiv. 295-300; (Gulland) xxxv. 114-116 ; Common, xxxiv. 4, 28, 30. SabInonidce, xxxiv. 4, 22; Double Embryos amongst, xxxvi. 301. Salomonson, J. K. A. W., on Supernumerary Pollex, xxxvi. 305. Salvi on the Arteria Dorsalis Pedis (mentioned), xxxiii. 504. Sand Eel, xxxiv. 3. Sanderling, xxxviii. 318. Saporito, Anomaly of the Rolandic Fissure (mentioned), xxxiii. 684. Sarcomatous Testicle and Uterus Masculinus (Primrose), xxxiii. 64-

Mater in, xl. 25; Placenta -of, xxxviii. 327--329, 340, 500; Popliteus Muscle in, xl. 35; Spleen of, xxxv. 424; Spontaneous Cure and Torsion of Aneurism in (Sharp), xxxii. 377- 379; Superior Oblique in, xxxix. 156, 157; Thyroid in, xxxvi. 201; Urethra in, xxxvi. 413415; Voluntary Muscles of, xxxiii. 600. Sheffield, Anthropological Collectious at (Patten), XL. p. iii. Shepherd, R. K., Form of the Human Spleen, xxxvi. p. lxxiv; xxxvii. 50-69. Sherrington on the Reciprocal Innervation of Antagonistic Muscles, xxxiii. 501. Shirres, Porencephaly, xxxvii. 305. Shore,_ Dr T. W., Unusual Arrangement of the Renal Portal Vein in the Frog (Rana temporaria), xxxiv. 398-402; Abnormal Veins in the Frog, xxxv. 323-329; on the Development of the Renal-Portals and Fate of the Posterior Cardinal Veins in the Frog, xxxvi. 20-46. Shoulder in Man and Mammals, xxxiv. 51. Shoulder Ligaments of Men and some Mammals, xxxiii. 501. Shrew, Cerebellar Fissures of, xxxvii. 113, 122, 123; Placenta of, xxxviii. 485; Development of, xxxviii 190, 199. Shrews, Dentition of, xxxvi. 335. Shrubsall on African Skulls (mentioned), xxxiii. 356; Study of Abantu and Ashanti Skulls (mentioned), xxxiii. 506. Shufeldt, Dr R. W., Osteology of the Penguins, xxxv. 390-404; Notes on the Osteology of Scopus umbretta and Balceniceps rex, xxxv. 405-412. Siamese, Skulls of, xxxvii. 399. Sibson's Fascia, xxxviii. 53 footnote, 55, 62; xxxix. 264. Siebourg on a Case of Male Pseudohermaphroditism (mentioned), xxxiii. 505. Sievers on Hour-glass Stomach, xxxiv. 419.
Sigmoid Colon and Rectum, Idiopathic Dilatation of, xxxii. 341; Flexure, xxxv. 53; Congenital Dilatation of, xl. 299; Transposed, xxxvi. 421. Significance of Anatomical Variations (Cunningham), xxxiii. 1-9. Silex, Central Innervation of the Eye Muscles (mentioned), xxxiii. 684. Silurids, Cranial Nerves in, xxxix. 210. Simia, Aortic Arch in, xxxvi. 389; Cerebellum in, xxxvi. 383; Pigmentation of Pia Mater in, xl. 26; satyrus, xxxv. 272; Nerve Supply of Pectineus in, xxxvii. 281 Parietal Suture in, xxxiv. 417. Si7niidce, xxxvi. 262; Innervation of Hand in, xl. 329. Simon, Case of True Hermaphroditism, xxxviii. 363. Simpson, F. O., Congenital Abnormalities of the Heart in the Insane, xxxii. 679-686. Sinibaldi on Aberrant Chordme Tendineae, xxxix. 505. Sinus Uro-genitalis, Persistent, xxxiii 521. Siredon pisciformis, Cerebellum of, xl 320. Sirenia, xl. 35; Aortic Arch in, xxxvi. 392, 393, 397; Cerebellum in, xxxvi. 383; Cerebral Sulci of, xxxvi. 312. Sirenomelian Monster, Anatomy of (Moorhead), xxxix. 450-461. Sitta casia, xxxviii. 318. Situs Mutatus in a Negro, xxxviii. 363. Skate, Development of, xxxviii. 84, 219, 221, 223, 344, 346; Intestinal Canal in, xxxv. 88; Common, xxxiv. 2, 27. Skates, Cranial Nerves in, xxxix. 208. Skeletal Abnormalities of a White Woman (Terry), xxxiii. 413-422; Malformations (Edington), xxxviii. 476-484. Skeleton of an Anencephalus (Cutore), xxxvii. 302; of a Eunuch, xxxiii. 500; of the Extended Hand, xxxiii. 350; of Face, Relation of, to Superficial

of the 'ruatara, xxxv. p. iv. Skulls from Ceylon (Corner), xxxii. 654-764 ; in the Anthropological Collection at Cambridge (Duckworth), xxxiii. p. xxxiv; from the Round Barrows of East Yorkshire (Wright), xxxviii. 119-132; xxxix.
the Ancient Egyptians, xxxvi. 375380; the Primary Subdivision of the Mammalian Cerebellum, xxxvi. 381-385; on the Presence of an Additional Incisor Tooth in a Prehistoric Egyptian, xxxvi. 386 ; on the so-called "Gyrus Hippocampi," xxxvii. 324-332; Note on an Abnormal Colon, xxxviii. 32-33; a Note on an Exceptional Human Brain, presenting a Pithecoid Abnormality of the Sylvian Region, xxxviii. 158-161 ; a Note on the Communication between the Musculospiral and Ulnar Nerves, xxxviii. 162-163; the Fossa Parieto-occipitalis, xxxviii. 164-169; Simia, Sylvian Fissure in, xxxviii 158, 168; Diminution in the Number of Carpal Bones, xxxviii. 372. Smith, S., Note on the Staining of Sections while Embedded in Paraffin, xxxiv. 151-152. S. M., and Jenkins, Dr G. J., on the Watersheds of the Peritoneum,
XVii. W. F. C., on a Derodyme Monster, xxxv. 501. Dr W. Ramsay, Abnormalities in the Sacral and Lumbar Vertebrae of the Skeletons of Australian Aborigines, xxxvii. 359-361. Sminthopsis, xxxvi. 331 ; leucopus, xxxvi. 332. Smooth Hound, xxxiv. 2. Snakes, Axial Bifurcation of, xxxvii. 303. Snipe, xxxviii. 318. Sobotta, J., on Homologous Twins, xxxvi. 301. Socia Parotidis, xxxvi. 47. "Socia Thymi Cervicalis," and Thymus Accessorius (Harman), xxxvi. 47-53. Soffiantini, Dr G., Sezione Mlfediana Verticale antero-posteriore 9nediante congelamtento di cadavere al sesto neso di gestazione (noticed), xxxi. 166. Soldier of Marathon, Statue by Jean Paul Cortot, xl. 54. Sole, xxxiv. 4, 34.

XL. p.

Solea aurantiaca, xxxiv. 4; valgaris, xxxiv. 4. Solenodon, xxxii. 728; Coracobrachialis Brevis in, xxxii. 726; Dentition of, xxxvi. 335, 336; cubanas, xxxvi. 334. Solenodontidce, xxxvi. 335. Solowy, Observations on Pseudohermaphroditism (mentioned), xxxiii. 682. Solpuqidw, xxxiv. 514; xxxv. 258. Somalicus, xxxviii. p. iv. Somatic nuclei, xxxvi. 249; Trunk Musculature and the Formation of an Atrial Cavity (Gaskell), xxxvii. 188200. Song Thrush, Elastic Fibres in the Eye of, x1. 22. Sonnberg, Foetus Papyraceus, xxxvii. 302. Sooty Phalanger, Popliteus Muscle in, xl. 35. Sorel on a Case of Pseudo-hermaphroditism (mentioned), xxxiii. 505. Sorex, Dentition of, xxxvi. 335; araneus, xxxvi. 334; vulgaris, Cerebellar Fissures of, xxxvii. 122, 123, 129; Placenta of, xxxviii. 485.

Molar and Premolar Teeth in the Mammnalia (Tims), xxxvi. 321-343. Suidce, Aortic Arch in, xxxvi. 392: Teeth in, xxxvii. 143. Sulci, Cerebral, Homologies of, xxxvi. 309-319. Sulcus Terminalis of Vene Cavee,

XXXVII. p. Vii.

Stoyanov on Polymastia and Polythelia, xxxiii. 503; xxxiv. 418. Strand Mole, xxxii. 430. Stratum Corneum in Man (Macleod), xxxvi. pp. lvi-lix. Straussmann on Twins and Double Formations, xl. 295, 296; on Multiple Formations in Man, xl. 296. Strickland-Goodall, J., the Comparative Histology of the Urethra, xxxvi. 405-416. Stridulating Apparatus in Phrynidw, xxxvi. 179. Strobe on Hermaphroditism, xxxiii. 521. Strong, Congenital Tumours of the Kidney, xxxviii. 369. Stroud, B. B., Note on the Staining of Isolated Nerve Cells (mentioned), xxxiii. p. ix; Preliminary Account of the Degenerations in the Central Nervous System of Frogs deprived of the Cerebrum (mentioned), xxxiii. p. ix. Structure of the Third, Fourth, and Sixth Cranial Nerves (Barratt), xxxv. and Function of the 214-223 Epididymis and Vas Deferens in the Higher.Jfavnmalicc (Myers-Ward), xxxii. 135-140 ; as illustrated by the Form of the Lower Epiphysial Suture of the Femur (Thomson), xxIvi. 95-105; of Heemolymph Glands (Drummond), xxxiv. 198-222; and Morphology of the Intromittent Sac of the Male Guinea-pig (Cole), xxxii. 141-152. Studies from the Anthropological Laboratory, the Anatomy School,
Cambridge (Duckworth), (Notice),
xxxix. 370; in Cranial Variation (Russell), (Notice), xxxv. 275. Sturgeon, Common, xxxiv. 2, 28, 30. Sturn'us vulyaris, xxxviii. 318. Stylonurus, xxxiv. 467. Styrnium aluco, xxxviii. 318. Sublingual Gland, xxxv. 35. Submaxillary Gland, xxxv. 34. Subungidata, Popliteus Muscle in, xl. 35. Succession and Homologies of the
Sulcus. See Brain--Sulcus. Sulphates in Hibernating Gland, xxxviii. 23. Sun-fish, xxxiv. 4, 30. Supernumerary Bone in Carpus attached to Trapezium (Fawcett), xxxiv. p. lii; Bones of Foot, xxxvii. 310; Breast in a Man, xxxii. 789; Breasts, xxviii. 367; Carpal Bones (Johnston), XL. p. xvii; Dorsal Fin in a Trout sSeligmann), xxxv. 501; Kidney (Barlet), xxxix. 507 ; Limb in Frog (Gemmill), xl. 387-395; Lobe of the Right Lung (Du Sejour), xxxix. 505; Mamma, xxxiii. 503; xxxv. 503; Mammms, xl. 300; Molars, xxxviii. 365; Muscles of the Pectoral Region, Derivation and Significance of certain Supernumerary (Huntington), xxxix. 1-54; Pollex, xxxvi. 305; Radio-palmar Muscle (Kater), xxxvi. 76; Teeth, xxxix. 119-134, 197 ; in Horse, xl. 298; Suprarenals, xxxiii. 505. Supra-clavicularis Proprius Muscle (Laidlaw), xxxvi. 417-418. Supra-condyloid Foramen (Dwight), xxxix. 507. Supra-patellar Ossicle, xxxv. 122. Supra-pubic Prostatectomy, xl. 201 et seq. Suprarenal Bodies. xxxiii. 505; xxxvii. 207; Shape of, xxxiii. 252; Topographical Anatomy of (Birmingham), xxxi. 109 ; Suprarenal Body, Left, Position of, xxxv. 300; Suprarenal Glands, Cortical and Medullary (Vincent). xxxviii. 34-48. Supra-sternal Ossifications, xxxv. p.

Surface-markings on the Calvarium, Significance of (Dixon), xxxiv. p. 1. Surgical Anatomy of the Prostate (Walker), XL. pp. vii-viii, 189-209.
1NDEX TO VOLS. XXXI.-XXXIX.
Suricata tetradactyla, Condylo-tibialis in, XXXIX. p. xxxv; Popliteus Muscle in, xl. 35, 41, 43. Suricate, Hip of, xxxiv. 303; Popliteus Muscle in, xl. 35 ; Spleen of, xxxv. 423. Surinam Toad, Diaphragm represented in, xxxix. 253. Sus, Cecum of, xxxv. 98; Coracobrachialis Brevis in, xxxii. 726; domtesticus, Hoemolymph Glands of, xxxi. 179, 196; Pectineus in, xxxvii. 279; scrofa, Ossification of Femur in, xxxvi. 97. Sutton, Bland, Abnormal Articulation between Astragalus and Cuboid, xxxiii. 498; Teeth in the Temporal Bones of Horses, xxxviii. 305. Suture, Parietal, in Simnia satyrus, xxxiv. 417. Swallow, Elastic Tissue in Eye of, xl. 112. Sweet William, xxxiv. 2. Swine, Polydactyly in, xxxix. 508. Swiss Skulls, xxxiii. 356. Sykes' Monkey, xxxv. 95. Symbranchidce, xxxiii. 612. Syneles, xxxix. 450. Symelian Fcetus (Katz), xxxvii. 302. Symington, Prof. J., Notes on the Dissection of a Case of Double Knockknee, xxxi. 465-468; the Thymus Gland in Marsilpialia, xxxii. 278291; a Note on the Thymus of the Koala (Phascolarctos cinerius), xxxiii. p. xlvi; xxxiv. 226-227; the Marsupial Larynx, xxxiii. 3149; the Cartilages of the Monotreme Larynx, xxxiv. 90-100; a Comparison of the Pelvic Viscera and Pelvic Floor in Two Adult Male Subjects, xxxiv. 101-110; on the Articulations between the Occipital Bone, Atlas, and Axis in some of the Lower 1Iamnmalia (Title only), XXXIV. p. xiv; on a Specimen of a Heart with Incomplete Inter-auricular and Interventricular Septa, one Auriculo-ventricular Opening (left), and a Single Arterial Orifice (Aortic), XXXIV. pp. xiv-xvii; Additional Notes on the Articulations between the Occipital
Bone, Atlas, and Axis in Mamnalia (Title only), xxxv. p. xxi; on the Development of Digits in Cetacea (Title only), xxxv. p. xxi; Observations on the Development of the Human Brain before and after Birth (Title only), xxxv. p. xxi ; on Separate Acromion Process, xxxiv. 287-294; Relation of the Deeper Parts of the Brain to the Surface, XXXVI. p. lxv; Are the Cranial Contents Displaced and the Brain Damaged by Freezing the Entire Head? xxxvii. 97-106; Observations on the Relations of the Deeper Parts of the Brain to the Surface, xxxvii. 241250; Relations of the Deeper Parts of the Brain to the Surface, XXXVII. p. lxX; XL. p. ii; John Grattan's Craniometric Methods, xxxviii. 259274, p. xxviii; Observations on the Cetacean Flipper, with Special Reference to Hyperphalangism and Polydactylism, xl. 100-109; on the Topographical Anatomy of the Caput Gyri Hippocampi, XL. p. ix, 244-246. Symington, Prof. J., and Rudolf, Dr R. 1)., a Case of Cor Biloculare, XXXIV. p. xvii. Symmelia, xxxviii. 361, 362. Symmers, Prof. W. St C., Pigmentation of the Pia Mater, with Special Reference to the Brain of Modern Egyptians, xl. 25-27. Symmetrical Perforations of the Parietal Bones, including an Account of a Perforated and Distorted Cranium, from the Liverpool Museum (Paterson and Lovegrove), xxxiv. 228-237. Symmetry, Inversion of, xxxviii. 362. Sympathetic Innervation of the Aorta and Intercostal Arteries (Tebbs), 308-311. Symphysis Pubis, Diastasis of (Schauta), xxxiv. 419. Sympodia, xxxix. 450, 451. Symptoms of Asphyxia (M'Kenzie), xl. 120. Syncephalous Calf, xxxviii. 365. Syncephalus, xl. 296, 297. Syndactyly, xxxi. 463; xxxiii. 524; xxxvii. 310; xxxix. 509.

Teal, xxxviii. 318, 323; Displacement of Heart in, xl. 303. Tebbs, B. T., the Sympathetic Innervation of the Aorta and Intercostal Arteries, xxxii. 308-311. Teeth, Absence of Lateral Incisor and Hare-lip, xl. 298; Anomalies of (Bradley), xxxvi. 356-367; of Australians, xxxvii. 95 ; Congenital, xxxi. 459; Evolution of, in Mc/amrmalia (Tims), xxxvii. 131-149; Lower Human Premolars, xxxiii. 506; Succession and Homologies of, in Mlammalia (Tims), xxxvi. 321343, p. lix; Supernumerary, xxxix. 119-134, 197 ; in Australian Skull (Turner), xxxiv. 2713-274; in Horse, xl. 298; Supernumerary Molars, xxxviii. 365; in the Temporal Bones of Horses, xxxviii. 365. Telegony, xxxvi. 298. Teleostei, xxxii. 505, 696; xxxiii. 613 ; xxxiv. 3 ; xxxvii. 132, 202, 203, 208, 211; Branchial Arches in, xl. 82; Cardinal Veins in, xxxvi. 43 ; Cerebellum in, xl. 140, 142, 318, 320; Development of, xxxviii. 86, 210, 354 ; Head Kidney of, xxxviii. 34 et seq. ; Occurrence of a "Principal Islet" in the Pancreas of (Rennie), xxxvii. 375-378 ; Retina in, xxxix. 136; Superior Commissure in, xxxviii. 275, 279, 281, 283 Thymusin, xl. 98. Teimoin, an Accessory Spleen (mentioned), xxxiii. 683. Templeton, G., on Axillary Mamma, xxxiv. 418. Temporo-maxillary Joint, xxxiv. 41. Tench, xxxiv. 4, 28, 30, 33. Tenchini on a Variety of the Atlas (mentioned), xxxiii. 350. Tendon, Origin of Elastic Fibres in (Gemmill), xl 396-398 Cells, BranChilig YOUng (Gemmill), Xl. 398-399. Tenon's Capsule in Fishes, xxxiv. 25. Tenrec, Aortic Arch in, xxxvi. 390. Tentacular Segments, xxxiv. 552. Teratogenesis, xxxii. 783.
780-797; xxxiii. 507-526; xxxiv. 410-425; xxxv. 497-510; xxxvi. 296-308; xxxvii. 298-313; xxxviii. 360-374; xxxix. 496-512; xl 292302; Phenomena, Relation of Atavism to (Rabaud), xxxix. 496. Teratoma, xxxii. 786; Abdominal (Bayer), xxxix. 506; found in the Abdomen, xxxv. 504; Growing from Sacral Region, xxxvii. 303; of Labium, xl. 297; of Neck, xxxviii. 366 ; of Ovary, xxxviii. 370. Teratomata, xxxviii. 227; Abdominal, becoming Malignant, xxxiii. 520; Experimentally produced, xxxvi. 296. Teratome (Brunker, Hagenbach-Burckhardt), xxxiv. 416. Termination of the Posterior Tibial Artery and Nerve (Whittaker), xl: 186-187. Tern, Elastic Tissue in Eye of, xl. 115. Terry, Dr R. J., Rudimentary Clavicles and other Abnormalities of the Skeleton of a White Woman, xxxiii. 413-422. Testes, Abnormal, xxxii. 216, 217 Ectopia of, xl. 300 ; in Perineo, xxxviii. 370; of Sirenomelian Monster, xxxix. 453. Testicle, Sarcomatous Enlargement of Undescended (Primrose), xxxiii. 6475; Sessile Hydatid of, xxxvi. 147. Testicles, Abnormalities of, xxxii. 791. Testicular Teratoma (Petit), xxxix. 506. Testis, Veins of, xxxiii. 504. Testuedo grceca, Hermaphroditism in, xl. 294. Testut, Muscle Supernumeraire Radiopalmaire of, xxxvi. 76. Tetrodon lagocephalues, xxxiv. 4. Thalassarctos, Occipital Condyles in,

INDEX TO TOLSXXI.-XXXIX

Anastomoses, xxxiii. 355; Rib, Rudimentary First, in' Horse (Bradley), xxxvi.' 54-62; Organs in the.Lemur (Patten), xxxiii. p. xlvi; and Abdominal Organs, Influence of Body 'Posture on the Position and Shape of (Keith), xxxii. 451457. Thoracopags, xxxv. 501; xl. 297. Thorax, Malformations of, xl. 299; Photographs of. Sections of (Scott), XL. p. vii; Three Zones of, xxxvii.
Thorneley, Macropodia, xxxviii.' 372. Three-toed Sloth, Aortic Arch in, xxxvi. 393;' Ossification 'of Femur in, xxxvi. 97; Popliteus Muscle in, xl. 35. Thrush, Elastic Fibres in the Eye of, xl. 22. Thumb, Absence of, xxxi. 462; Absence of Superficial Flexors of (Hall), xxxvii. 287-289; Double, - Skiagraph of, xxxiii. 500; Dwarfing of, xxxviii. 476; Hereditary Stiffness of Metacarpo-phalangeal Joint of (Wilgress), xxxii. 753;. with Proximal Phalanx bifurcated, xxxviii. 371 ; Supernumerary, xxxvi. 305; Triphalanged, xxxviii. 371. Thyestes verrucosus, xxxiv. 507, 570. p. xxvii ; xxxvi. Thylacinus, 331, 334, 335; Aortic. Arch in, xxxvi. 394, 396; Cerebral Sulci, xxxvi. 312 ; Coraco-brachialis Brevis in, xxxii. 726; Muscles of Hind Limb of, xxxix. 310, 311, 313, 316,

xxxiii.

321, 322, 324, 327 ; cynocephalus, xxxvi. 332 ; Ilio-coccygeus in, xxxv.
Thymus, xxxvi. 47; Accessorius, etc. (Harman), xxxvi. 47-53; Anatomy and Histology of, xxxviii. 322-323; Atrophied, xxxvi. 68; Development of, in Lepidosiren paradoxa (Bryce), xl. 91-99; Function of, xxxviii. 344; Origin of, xxxvii. 210; of the Koala (Synlington), xxxiii. p. xlvi ; xxxiv. 226-227 ; of Macropus, xxxii. 130; in the Mfarsupialia (Symington), xxxii. 278-291. Thynnus thunnina, xxxiv. 3.
Thyro-glossal'Duct, xxxtVi. 418. Thyroid, :xxyi. pJ xxv; Abnormal, xxxvi. 418; in Cretinism and Myxcedemd, xl; 293;.Function' of, xxxiii.662; in Amnmoccetes, xxxiii. 616, 638; Innervation of, xxxiii.' 354; Origin of, xxxvi. 201-203 or Opercular Segment in Vertebrates, xxxiii. 638-671; Cartilage in Monotremes, xxxiv. 91. See Gland. Thyroidectomy, the Effect of, on Nitrogenous Metabolism (Parsons), xxxv. 476-486. Tibial Groove for the Popliteus Muscle, xxxiii. 351. Tiger, Epiphysis of Great Trochanter in, xxxviii 257. Tiliqua scincoides, Sesamoid 'Bone in,.'xxxviii. 250. Tims, Dr H. W. M., on the Succession and.'Homologies of the Molar and Premolar Teeth in the Mammalia, xxxvi. 321-343, p. lix; the Evolution of the Teeth in the Mammalia, xxxvii. 131-149. Tinca tinca, xxxiv. 4; vulgaris, xxxiii. 612. Tissot, J., on Hexadactyly, xxxiii. 523. Titmouse, Elastic Tissue in Eye of, xl. 113. Toad, Absence of Pharyngeal Constrictor in Tadpole Stage, xxxvi. 237; Development of Retina in Tadpole of, xxxix. 152, 334; Development of Tongue of, xxxvi. 238; Innervation of Muscles in, xxxvii. 85, 86; Muscular Bands representing Diaphragm in, xxxix. p. iii, 253; Superior Commissure in, xxxviii. 281, 288. Todd, Prof. G. B., the use of Colour Screens for Microphotography, xxxi.

114-115.

Toes, Congenital Hypertrophy of, xl. 301; Duplication of Fifth, xxxvii. 310; Great, Normal Position of (Griffiths), xxxvi. 344-355, p. xlv. Tolypeutes, Cerebral Sulci of, xxxvi. 313; Muscles of Hind Limb of, xxxix. 326. Tongue, Anatomy of, xxxv. 35; Bifid, xxxvi. 304; Muscles, Innervation
of, xxxiv. 134; Muscles of Newt, xxxvi. 234; of Fowl, Joint in, and its Vocal Function, xxxv. 413-415; of Macropus, xxxii. 131 ; of Toad, Development of, xxxvi. 238. Tonkoff, Dr W., on a Case in which the Dorsal Cutaneous Branches of the Musculo-spiral replaced the Radial Nerve in the Supply of the Back of the Hand (mentioned), xxxiii. 353; the Arteries of the Intervertebral Ganglion and of the Centro-spinal Nerves in Man, xxxiii. 503. Tonsil, Relations of, xxxv. 38; Relation of the Facial and External Carotid to, xxxiv. p. xxxi. Tooth, Additional Incisor in Prehistoric Egyptian (Smith), xxxvi. 386; Form, Linear Determination of the Human (Pearsall), xxxii. 219222; Variations in the Human, as met with in isolated Teeth (Taylor), xxxiii. 268-272; Genesis in Manzmnalia, xxxvii. 131-149; Supernumerary, xxxi. 459. Topographical Anatomy of the Adult Human Skull (Scott), xl. 171-185; of the Abdominal Viscera in Man, especially the Gastro-Intestinal Canal (Addison), xxxiv. 427-450; xxxv. 166-204, 277-304; xxxvii. p. lxxvii; of the Brain (Jenkins), XXXIX. p. xiii; of the Caput Gyri Hippocampi (Symington), XL. p. ix, 244-246; of the Skull (Scott), xxxix. p. xxxvi; of Spleen, Pancreas, Duodenum, Kidneys, etc. (Birmingham), xxxi. 95-113 ; of the Viscera of Hylobates haianus, xxxvi. p. lxvi. Topographical Atlas of the Spinal Cord (Bruce), (Notice), xxxv. 428, 429. Topographical Sketch of the Lateral Wall of the Pelvic Cavity, with Special Reference to the Ovarian Groove (Waldeyer), xxxii. 1-10. Topography of Abdominal Viscera, xxxiii. 210; of the Brain (Jenkins), xxxix. 462-470; of the Facial Nerve in its Relation to Mastoid Operations 'Joyce), xxxiv. 248-255.
Torpedinidce, xxxii. 498; xxxiv. 2. Torpedo, Development of, xxxviii. 84, 217, 220, 221 ; Electric Organ of, xxxix. 384; Pronephric Duct in, xxxvii. 171; Ray, xxxiv. 2; maculata, xxxii 498; narke, xxxii. 498; xxxiv. 2; ocellata, Cranial Segments of, xxxiii. 157; unimatulata, xxxii. 498. Torticollis, Congenital (Gallavardin and Lavy), xxxix. 504. Tortoise, Blood Sinuses in, xxxvi. 44; Intestines of, xxxviII. p. xx; Respiration in, xxxix. 273 footnote. Torus Uterinus, xxxvi. 135. Totipalnatce, xxxv. 412. Tourneux on the Early Development of the Pituitary Body (mentioned), xxxiii. 506. Trabecule of Lymphatic Glands, xxxix. 185. Tracing, Demonstration of, to Large Audiences (Colquhoun), xxxviii. 293294. Traction Epiphyses, xxxviii. 248-258; xxxix. 402. Tractus Olfactorius Septi, xxxii. 55; Septo-mesencephalicus, xxxii. 55. Tragelaphics, xxxiv. 55; scriptus, xxxiv. 67, 311. Tragublts, xxxiv. 56; stanleyanus, xxxv. 98. Traits des Variations de Syste'ie Miisculaire de l'Hoanme, et leur Signification aic Point de Vie de 'tAnthropologie Zoologiqce (Double), (Notice), xxxii. 608. Transposition of the Great Vessels, xxxiv. 419; of Viscera, xxxi. 446; xxxiv. 411; xxxvii. 300; xxxviii. 363; xxxix. 499; xl. 28-33, 294. Transverse Colon, xxxv. 53. Traumatic Separation of the Epiphyses (Poland) (noticed), xxxiii. 686. Tredgold, A. F., Variations of Ribs in the Primates, with Especial Reference to the Number of Sternal Ribs in Man, xxxi. 288-302. Tree Porcupine, Aortic Arch in, xxxvi. 391; Wallaby, Aortic Arch in, xxxvi. 394.

Tremataspis, xxxvi. 196; mickwitzi, xxxiv. 507. Trevelyan, Prof., Prepiration of Dry Brain Specimens, XXXVI. p. xxv. Trevor, R. S., a very long Vermiform Appendix enclosed in a Canal behind the Caecum and Ascending Colon, xxxvi. pp. xlii-xliv; Heart with various Malformations, xxxvi. p. xliv. Triacanthus, Click Mechanism of the Ventral Fin of, xxxv. 211. Yriacis semifasciata, xxxii. 487, 500; xxxiii. 229. Triangular Ligament, xxxviii. 438. Triarthues, xl. 306. Trichecus rosmarus, xxxiv. 303. Trichosuerus, xxxi. 515, Cerebellum of, xxxvi. 384; xxxviii. 329, 332; Facial Index of, xxxvi. 329, 334; Muscles of Hind Limb of, xxxix. 309, 310, 314, 316, 318, 320, 321, 324, 326, 327 ; fuliginosus, Popliteus Muscle in, xl. 35, 38, 43; Movement between Bones of Leg in, xl. 46 vulpecula, xxxvi. 330, 332; Popliteus Muscle in, xl. 35, 38, 43; Thymus in, xxxii. 286. Triconodon, xxxvii. 139; Teeth of, xxxvi. 321. Trigeminal Group of Nerves, Meaning of, XXXIV. p. xxv; Nerve, Morphology of, xxxiv. 465. 484. Trigla pini, xxxiv. 3. Trigone of Bladder, xl. 195. Trigonum Femorale, xxxvi. 131, 141. Trilobita, xxxiv. 475; xxxv. 266. Trilobite-like Animal, Sections of, xxxvii. 194, 195. Trilobites, xxxiv. 476; xxxv. 259, p. v; xxxvii. 175, 196; Ventral Groove in, xl. 306, 307, 315. Trinil Femur (Pithecanthropus erectuts), contrasted with the Femora of various Savage and Civilised Races (Hepburn), xxxi. 1-17. Triphalanged Thumb, xxxviii. 371. Triphalangy, xxxvii. 310. Triplets (Thompson), xxxiv. 415 (Watson), xxxix. 501 ; Monstrous, xxxviii. 365; Unioval, xxxvii. 302.
Triton, Development of Head-cavities in, xxxvii. 85; Pineal Body in, xxxvii. p. lxxix; cristaties, xxxvi. 210; tceniatuis, Supernumerary Limb in, xl. 395. Tritubercular Theory, xxxvii. 136. Troglodytes Gorilla, Nerve Supply of Pectineus in, xxxvii. 281 ; niger, xxxv. 271; Double Pectineus in, xxxvii. 279, 281 ; vulgcaris, Elastic Tissue in Eye of, xl. 113. Trolard, the Posterior Subdivision of the Cervical Nerves (mentioned), xxxiii. 685. Trombidium, Muscle of, xxxi. 321. Trout, xxxiv. 22, 28; Double Embryos (Gemmill), xxxix. 502; Gastrulation of, xxxvii. 304; Double Malformations in, xxxvi. 300. Trunk Myotomes in Newt, xxxvi. 235 Truettafario, xxxi. 457. Trygon, xxxiii. 613. Elastic Trypanocorax frugilegus, Fibres in the Eye of, xl. 21. Tschaussow on Polish Crania, xxxiii. 213. Talaeara, Developing Skull of, xxxv. p. iv. Tubercle of Lower, xxxvii. p. xviii. Tuberculum Impar, xxxvi. 238; 01factorium, xxxii. 35. Tlbinares, xxxv. 391. Tubular Hermaphroditism in the Male, with Sarcomatous Enlargement of an Undescended Testicle (Primrose), xxxiii. 64-75. Tucker on Proptosis with Oxycephaly, xxxix. 504. Tuffier, Study of the Vermiform Appendix and Ileo-ceecal Region (mentioned), xxxiii. 683.

Tumbler-pigeon, Dichotomy in, xxxvii.
373 footnote. Tumour of Arm, xxxviii. 371. Tumours, Embryology of, xxxviii. 364; Teratological nature of (Rabaud), xxxvii. 299. Tunicata, xxxiii. 662; xl. 310. Tunny-fish, xxxiv. 3, 28, 30. Tupaja javanica, Development of, xxxviii. 190, 199; Placenta of, xxxviii. 485.
INIDEX TO VQL5. XXXI.-XXXIX,
"First-laid" Eggs, xl. 292; Double Malformation of Lacerta oetlata, xl. 297; on Multiple Em. bryos, xl. 296. Turbot, xxxiv. 4, 34. Itardus merula, xxxviii. 318; Elastic Tissue in the Eye of, xl. 23; Musicus, Elastic Tissue in the Eye of, xl. 22; viscivorus, Elastic Fibres in the Eye of, xl. 22. Turkey, Hiemal Glands of, xxxviii. 317, 318, 324; Heemolymph Glands in, xxxi. 177; Left Auriculo-ventricular Valve in, xxxvi. 16. Turner, P., two Common Carotid Arteries arising from a Common Trunk, XL. p. xiv; Right Subclavian Artery arising from the Dorsal Aorta, XL. p. XiV. Turner, Prof. Sir. W.,.Notes on the Dissection of.a Third Negro, xxxi. 624-626; a Decorated Sculptured Human Skull from New Guinea, xxxii. 353-361; Moderator Band in Left Ventricle and Tricuspid Left Auriculo - ventricular Valve, xxxii. 373-376; a Rare Form of Palatal Suture, xxxiii. 674, 675; an Australian Skull with Three Supernumerary Upper Molar Teeth, xxxiv. 273-274; Double Left Parietal Bone in a Scottish Skull, xxxv. 496; Hyoid Apparatus in Man, in which a Separate Epi-hyal Bone was Developed, xxxvi. 162, 163 ; the General Characters of the Crania of the People of Scotland, xxxvii. 392408 ; Preface to the Fortieth Volume,

XL. pp. i-Vii.

Tylecote,

Patent xxxviii. 367.

Foramen Ovale;
Tylosis, Hereditary, xx2ci. 463; Palmoe,.

xxxiii. 513.

Tyson's Glands, xxxiii. 505.
UHL on Absence of one Kidney, xxxix. 507. Ulmann on Atresia of the Alimentary Canal, xxxiii. 520. Ulrich, P., on Malformations of the Female Genitalia, xxxiv. 421. Umbilicus, xxxiii. 578. Umbre, Skeleton of, xxxv. 405. Undescended Testicle, Sarcomatous. and Uterus masculinus (Primrose),

xxxiii. 64-75.

Ungtlata,

91 ; Aortic Arch in,

xxxvi. 392,
395, 397; Brachial Plexus in, xxxviii. 412; Cerebellum

polaris, Occipital Condyles of, xxxvi. 370; thibetanuts, Qccipital Condyles -of, xxxvi. 371 ; (Melutrsus) labiatus, Occipital Condyles of, xxxvi. 368,
Use of Colour Screens fox Microphotography (Todd), 114, 115. Uteri of Ischiopagus trips, xxxvi.
266. Uterus, Abnormalities of, xxxvii. 308; Absence of, xxxii. 792; ,xxxv. 505; xxxvii. 308; Arcuatus, Bicornis, Didelphys, Duplex and Septus, xxxv. 504, 505; Bicornis, xxxvii.308 Didelphys, xxxvii. 308; Divided, xxxi. 461; Double, xxxviii. 369; XL. p. Xi; with Cloaca, xxxiv. 420; Duplex, xxxiii. 354, 522; xxxvi. 297; x]. 299; Duplex Bicornis (Heinricius), xxxix. 507; Alalformations of, xxxviii. 369; Masculinus, xxxiii. 650 ; Tubular Hermaphroditism in the Male, with Sarcomatous Enlargement of an Undescended Testicle (Primrose), xxxiii. 64-75; Septate, xl. 300; Unicornis, xxxvii. 308; of Indian Elephant, xxxii. 590; of a Macacus rhesus (Keith), xxxiv. p. xlvi; and Vagina, Absence of, xxxiii. 522. Uvula, Abnormalities of, xxxiii. 517; Anomalies of, xxxiii 354 ; Bifid, xxxv. 502.
VAGINA, Absence of, xxxii. 792; xxxiii. 522 ; xxxiv. 421 ; xxxix. 507.; Atresia of, xl. 300; Development of (Hart), xxxi. 18-28; Double, xxxiv. 420;' XL. p. xi; Lymphatic Supply of, xxxv. 344; Septate, xl. 300; Structure and Origin of, xxxv. 342; with Transverse Septum, xxxv. 365 of Indian Elephant, xxxii. 592; and Uterus, Dtiplicity of, xxxv. 504. Yaginal Cysts, xxxviii. 370; Rugoe, Arrangement of, xxxv. 343; Septumi xxxvi. 305. Valenti, G. R., on a Bifurcated Third Rib, xxxvi. 304. Valvulze Conniventes, xxxv. 47. Van Dyck's " Sleeping Boy," xl. 55. Van I)uyse on a Case of Cyclopia,
LNDEX TO VOLS. XXXI.-XXXIX.
Cava Inferior, Absence of (Phisalix), xxxiv. 420; Absence of, below the Diaphragm (Dwight), xxxv. 7-20; Absence of Hepatic Section of, xxxvi. 63-75, p. xxvi; Anomalous, xxxv. 123; Atresia of, xxxii. 792; Double, xxxv. 123; Duplicity of (Gorron), xxxv. 504; Obstruction of, xxxiii. 503; Orifice of, xxxvii. p. vii; Cava Superior, Orifice of, XXXVII. p. vi;, Persistent Left, xxxvii. 387; Left, in a Dog, xxxvii. 307; Dorsal, of Penis, xl. 201; External Jugular, xxxviii. 64; Femoral, xxxi. 625; Iliacs of Frog, xxxvi. 34; Innominate in Frog, xxxv. 327; Anomaly of Left, xxxvii. 307 ; Mesenteric, Splenic and Haemorrhoidal of Frog connected to the Left Lung, xxxv. 325; Mesonephric Parts of the Cardinal Veins, Union of, xxxvi. 31 ; Pancreatic, xxxv. 65; Pancreatico-duodenal, Anterior or Inferior, xxxv. 65; Posterior, xxxv. 65; Cardinal, Partial Persistence of, xxxvi. 305; Cardinals in Frog, xxxvi. 20-46; in Tadpole, xxxvi. 21-31 ; Prostatic Plexus, xl. 201; Pulmonary Opening into Coronary Sinus, xxxvii. 385; Renal Portal, Unusual Arrangement of, in the Frog, xxxiv. 398-402; xxxv. 323; Portals in Elasmobranchs, xxxv. 40; and Posterior Cardinals in Frog, xxxvi. 20-46; Renales Revehentes, xxxvi. 42; Renalis Advehens, xxxvi. 40, 42; Upper Pulmonary, Left, Opening into Innominate, XL. p. Xi. Veit on Polydactyly and Cerebral Malformations, xl. 300. Vena Cava. See Veins. Innominata. See Veins. Vermiform Appendix, Abnormal, in Rabbit (Hewitt), xl. 407-408; Abnormally Long, xxxiv. p. xxiv; xxxvii. 308; Absence of, XXXIV. p. lii; xxxv. 123; xxxviii. 368; Alterations in Level of, xxxv. 278; Average Position of, xxxv. 278; Comparative Anatomy and Histology of (Berry), XXXIV. p. 1; Development of, xxxv. 51 ; with Diverticula (Hedinger), xxxix. 507; Enclosed

Vertebrate Ear, Origin of (Gaskell), xxxv. p. xiii; Eye, Origin of, and Meaning of the Second Pair of Nerves (Gaskell), Xxv. pp. iv-vi; Head, Segmentation of, xxxix. 199; Retina, xxxix. 137. Vertebrates, Hemolymph Glands of (Vincent and Harrison), xxxi. 176198; Origin of, deduced from the Study of Ammocetes (Gaskell), xxxii. 513-581 ; xxxiii. 154-188, 638-671; xxxiv. 465-587; xxxv. 224-267; xxxvi. 164-208; xxxvii. 168-219; xxxix. 371-401 ; xl. 306317. Vervet Monkey, xxxiv. 57, 306, 317. Verworn's Hypothesis of Muscular Contraction, xxxii. 190. Vesico-prostatic Plexuses, xl. 202. Vesicula Seminalis, Absence of, x]. 300. Vesicule Seminales, xl. 207, p. viii ; in Boar and Pig, xxxi. 270, 273. Vesicular Mole, xxxvii. 299. Vespertilio, Muscles of Hind Limb of, xxxix. 327 ; marines, Placenta of, xxxviii. 487.
Anthropology oi e Philippines (mentioned), xxxiii. 685. H., on the Skeleton of the Extended Hand (mentioned), xxxiii.
R., on Phocomelia, xxxiii.
Virden, J. E., on Displacement of the Left Scapula, xxxiv. 422. Virginian Opossum, Ossification of Femur in, xxxvi. 97. Viscacha, xxxii. 728; Absence of Coraco-brachialis in, xxxii. 315; Aortic Arch in, xxxvi. 391; Coronal Suture in, xl. 243; Pelvis of, xxxvii.
Viscera, Abdominal, Topography of,
xxxiii. 210, 565-586; Abnormalities' of (Lawrence and Nabarro), xxxvi. 63-75; Complete Transposition of (Caton), xxxi. 446; Congenital Malformation of Hollow (Thomson), xxxvii. 299; Ectopia of (Paterson
INDEX.0 VOLS. iXXXLt-XXXINt
'andR&Rerts), XL'. p. ix; Inversiodi of,. (Lenormant and Durand-Viel), xxxv, 499; Models of, xxxVI. p. xlil; XXXviI. p. lxviii; Pelvic, Anatomy of (Dixon), xxxv. P. xix; Preparation of, for Demonstration, p. xxvii; Transposition of,
Vulpine Phalanger, Xxxiv. 50; Pop.itens Muscle in, xl. 35. Vulva of Indian *Elephant, xxxii. 597.
WAGTAIL, xxxviii. 318. Wahby, B., Abnormal Nasal Bones, xxviii. 49-51. Wakefield, P. A. Congenital Malformation of the Liver, Absence of the Lobus Spigelii, Rudimentary Quadrate and Left Lobes, with Enlargement of the Right Lobe, xxxiii. 50-53: Waldeyer, Prof. W., Topographical Sketch of the Lateral Wall of the Pelvic Cavity, with Special Reference to the Ovarian Groove, xxxii. 1-10. Walker, Malformation of Hand, xxxvii.

xxxvii. 300; xxxix. 499;

of Hylobates hainanus,

Visceral Anatomy, Papers

on, xxxiii.
Visual System of Brain, xxxi. 627. Vital Phenomena, Dissociation in (MN'Kendrick), xxxix. 285-294. Vitality of the Ova and Spermatozoa of certain Animals (Gemmill), xxxiv.

163-181.

Vii-erra xxxii. 730 ; civetta, Cerebellum of, xxxviii. 470; xxxix. 116; malaccensis, Cerebellum of, xxxviii. 471. Vicerridce, Hip in, xxxiv. 303; Popliteus Muscle in, xl. 35. Vocal Cords, xxxiii. 39; Function of Joint in a Fowl's Tongue, xxxv. 413415; Resonance, xxxi. 355. Voisin and Nathan, Triphalanged'

Thumnb, xxxviii. 371. Voles, Cerebellar Fissures of, xxxvii. 125. Volkov, Supernumerary Bones of Foot, and Triphalangy, xxxvii. 310. Volpa, Diphallus, xxxviii. 369. Volvox globator, xxxix. 394. Volvulus formed by Cuecum, Ascending Colon, and Ileum, XXXViI. p. ii; of Small Intestine., xxxvii. p. ii. Von Beneden, E., an Archentericd Canal ill Man (mentioned), xxxiii. 684. Von Ebner on the Walls of the Capillary Veins in the Spleen (mentioned), xxxiii. 682. Von Zoege-Manteuffel, Axial Rotation of the Caecum (mentioned), xxxiii. 682. Vowels, Genesis of (Lloyd), xxxi. 233239; Interpretation of the Phonograms of Vowels, xxxi. 240-251. Vram on the Lower Human Premolars (mentioned), xxxiii. 506.
H. S., Age Changes, and Surgical Anatomy of the Temporal Bone, p. xxvi. J. W. T., on the Surgical Anatomy of the Prostate, XL. Pp. vii-viii, 189-209. Walla, Unioval Triplets, xxxvii. 302. Wallaby, xxxiv. 312; Aortic Arch in, xxxvi. 394; Coronal Suture in, xl. 242; Genital. Tract in, xxxv. 347; Myology of, xxxix. 41; Ossification of Femur in, xxxvi. 97, 103 ; Pelvis of, xxxvii. 319. Wallenstein on Promelia, xxxiv. 421. Walrus, Hip of; xxxiv. 303; Occipital Condyles of, xxxvi. 371 ; Teeth of,

xxxvii. 134.

Walsh, Dr J. F., on

Myology of the

Hand, xxxiii. 500. Ward, Uterus Didelphys, xxxviii.

I"

Waring, J. H., Abnormal Junction.of Cystic and Hepatic Ducts, xxxiiI.
Warrington and Monsarrat, Defects of Central Nervous. System, xxxvii 305. Warthin, A. S., on, an Accessory Adrenal, xxxv. 504. Water in Hibernating Gland, xxxviii.

Chevrotain,

Aontic,

Ai~chi

INDEX -TO VOLS. XXXI.-XXXIX.
xxxvi. 3g2; Myology of, XXXVIII.

p. iii.

Watersheds of the Peritoneum (Smith and Jenkins), x,. p. xvii. Waterston, D., An Osteometric Index Calculator, xxxiii. 301-303; Craniometric Observations in the Postmortem Room, xxxiv. 256-259; Notice of Book, Taylor's Applied Anatomy, xxxix. 118; the Edinburgh Stereoscopic Atlas of Anatomy (Notice), xxxix. 368; Extreme Displacement ofthe Stomach, xxxix. p. xiv; an Unusual Displacement of the Heart, xl. 303-304. and Hepburn, Prof. D., a Comparative Study of the Grey and White Matter of the Motor-cell Groups, and of the Spinal Accessory Nerve in the Spinal Cord of the Porpoise (Phocena communes),
Weber on Reticular Formation of the Right Auricle. and Anomalous Foramen Ovale (mentioned), xxxiii.e 682 Weeper Capuchin, Ossification of Femur in, xxxvi. 97. Weigert-Pal Method, Nature of (Bolton), xxxii. 247-266; Process, Range of Applicability of certain Modifications of (Bolton), xxxiii. 292-300. Weight of Right and Left Sides of Fcetus (Moorhead), xxxvi. 400404. Weigner on the Otic Ganglion (mentioned), xxxii. 684. Weill, E., and PeThu, M., on a Congenital Defect of the (Esophagus, xxxvi. 303. Weinberg on Diprosopus Tetrotus Henicranius, xxxix. 503. Weissenberg on a Case of Congenital Malformation, of the Limbs, xxxiii. 524. Wells, B. H., on Duplicity of the Uterus and Vagina, xxxv. 5.04. Welsh, Dr D. A., Concerning the Parathyroid Glands, a Critical, Anatomical, and Experimental Study, xxxii. 292-307, 380-402. Westerman, Case of Hermaphroditism, xxxvii. 301. Wetzel, G., on a Ring-snake's Egg with Four Centres of Development, xxxv. 501. Wex, Histology of the Pharyngeal Tonsil (mentioned), xxxiii. 682. Weygandt on Cretinism, xxxix. 499. Whale, Flippers of (Symington), xl. 100; Sowerby's, xxxii. 375; Whalebone, xxxii. 376. White, Dr C. P., on Displaced Kidneys, xxxiii. 355; a Differential Stain for Muscular and Fibrous Tissues, xxxv. 145-146. White Line of Levator Ani, xxxv. 132of Pelvic Fascia, xxxv. 132. Whiteley, Data for the Problem of Evolution in Man,-I. First Study of the Variability and Correlation' of the Hand (mentioned), xxxiii. 679.